Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Regulatory protein AraR mutant synthesized by fungus alpha-L-arabinofuranosidase and application thereof

A technology of furanosidase and regulatory protein, applied in the field of mutants of fungal α-L-arabinofuranosidase synthesis regulatory protein AraR, and mutants of arabinofuranosidase synthesis regulatory protein, which can solve the problem of low yield

Active Publication Date: 2019-04-02
SHANDONG UNIV
View PDF9 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the current low yield of fungal α-L-arabinofuranosidase, the object of the present invention is to provide a mutant of fungal α-L-arabinofuranosidase synthesis regulatory protein AraR and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Regulatory protein AraR mutant synthesized by fungus alpha-L-arabinofuranosidase and application thereof
  • Regulatory protein AraR mutant synthesized by fungus alpha-L-arabinofuranosidase and application thereof
  • Regulatory protein AraR mutant synthesized by fungus alpha-L-arabinofuranosidase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Amplification of the gene encoding the Penicillium oxalicum α-L-arabinofuranosidase regulatory protein AraR mutant

[0036] Strain: Penicillium oxalicum wild strain 114-2, which was deposited in China General Microorganism Culture Collection Management Center on September 28, 2011, with the preservation number CGMCC 5302. The GenBank accession number of the genome sequence is AGIH00000000.1. This strain has been disclosed in the patent "An extracellular aldonolactonase PoALAC and its application" (patent number: ZL 2016 1 1056999.7) previously applied by the applicant.

[0037] The amino acid sequence of AraR in Penicillium oxalicum is shown in SEQ ID NO.1. Using the genomic DNA of Penicillium oxalicum 114-2 as a template, the front-end coding sequence of araR was amplified using primers araR-CDS-UF and araR-CDS-UR, and araR was amplified using primers araR-CDS-DF and araR-CDS-DR The back-end coding sequence and terminator sequence, and introduce the nucleic...

Embodiment 2A

[0048] Example 2 AraR Mutant AraR A731V Construction of encoding gene expression cassettes

[0049] In order to express AraR and its mutant AraR A731V , using primers gpdA-F and gpdA-R to amplify the gpdA gene promoter of Aspergillus nidulans, and using primers hph-F and hph-R to amplify the hygromycin B phosphotransferase gene hph expression cassette. The PCR procedure for fragment amplification is the same as in Example 1.

[0050] The primer sequences used in the above amplification process are:

[0051] gpdA-F:GTAAGGATTTCGGCACGG

[0052] gpdA-R: GGTGATGTCTGCTCAAGCGG

[0053] hph-F:CGACGTTAACTGATATTGAA

[0054] hph-R:CAACCCAGGGCTGGTGACGG

[0055] Using the overlap extension PCR method, the amplified fragment was fused according to the order of gpdA gene promoter, araR mutant coding region and terminator, and hph expression cassette to obtain AraR A871V Encoding gene expression cassette. The PCR procedure for fragment fusion is the same as in Example 1. The obtain...

Embodiment 3

[0056] Example 3 AraR Mutant AraR A731V Expression in Penicillium oxalicum

[0057] Strain: Penicillium oxalicum CX C , which was constructed by the applicant from the Penicillium oxalicum 114-2 strain described in Example 1, and the specific construction method is reported in the literature (Biotechnology Journal 2017, 12(11): 1700119).

[0058] Obtain AraR mutant AraR in embodiment 2 A731V Encoding gene expression cassette transferred into CX by protoplast transformation method C Bacterial strains, the reagent formula used is:

[0059] Protoplast transformation buffer:

[0060] Transformation solution S1 (100ml): 21.86g sorbitol, 1.36g KH 2 PO 4 , pH 5.6.

[0061] Transformation solution S2 (100ml): 18.22g sorbitol, 0.74g CaCl 2 , 0.12g Tris, adjusted to pH 7.5 with HCl.

[0062] Transformation solution T1 (100ml): 25g PEG 6000, 0.74g CaCl 2 , 0.12g Tris, adjusted to pH 7.5 with HCl.

[0063] The above transformation buffers need to be sterilized for later use.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a regulatory protein AraR mutant synthesized by fungus alpha-L-arabinofuranosidase. The mutant is obtained by mutating regulatory protein 731st alanine with an amino acid sequence as shown in SEQ ID NO.1 into valine, the amino acid sequence of the mutant is as shown in SEQ ID NO.2, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.3. The invention alsodiscloses an application of the regulatory protein mutant in the production of alpha-L-arabinofuranosidase and alpha-galactosidase. Experiments confirm that the yield of alpha-L-arabinofuranosidase and alpha-galactosidase can be greatly enhanced by expressing the regulatory protein mutant in a fungal strain.

Description

technical field [0001] The invention relates to a mutant of arabinofuranosidase synthesis regulating protein and its application, in particular to a mutant of fungal α-L-arabinofuranosidase synthesis regulating protein AraR and its application. It belongs to the technical field of genetic engineering. Background technique [0002] Efficient enzymatic hydrolysis of plant cell wall polysaccharides is important in various industrial processes such as food, feed, paper and biofuel production. In the cell wall of many plant cells, hemicellulose and pectin (such as arabinoxylan and arabinogalactan) carrying α-L-arabinofuranoside residues on the side chain are the main components, which can Enzymes that hydrolyze L-arabinose from these polysaccharides play an important role in the efficient hydrolysis of these substrates, mainly α-L-arabinofuranosidase (EC number 3.2.1.55). Adding α-L-arabinofuranosidase can obviously improve the hydrolysis of xylan skeleton in arabinoxylan by xy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/385C12N15/31C12N9/24C12N1/15C12R1/80
CPCC07K14/385C12N9/2402C12Y302/01022
Inventor 曲音波李世英潘云军高丽伟刘国栋宋欣
Owner SHANDONG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More