Efficient recombinant vaccinia virus vector and establishing method thereof
A vaccinia virus vector and recombinant virus technology are applied in the field of high-efficiency recombinant vaccinia virus vector and its establishment to achieve the effects of saving time and cost and improving recombination efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1 Obtaining recombinant virus by transfecting gRNA-Cas9 plasmid
[0056] 1. Method
[0057] 1.1. Design of gRNA
[0058] For the Tiantan strain vaccinia virus TK region, design gRNA sequences through the website (http: / / crispr.mit.edu / , http: / / www.e-crisp.org / E-CRISP / ), including gRNA1, gRNA2 and gRNA3 ( Such as figure 1 shown).
[0059] The sequence of gRNA1 is: GAAACCGAGATAGAAATAAT;
[0060] The sequence of gRNA2 is: GTTATAGTAGCCGCACTCGA;
[0061] The sequence of gRNA3 is: GTGAGCGTATGGCAAACGA.
[0062] 1.2. Detection of expression and localization of Cas9 protein in gRNA-Cas9 plasmid
[0063] 1.2.1, protein extraction
[0064] At 293T (5×10 5 ) cells were transfected with px330-delNLS, px330-delNLS-gRNA1, px330-delNLS-gRNA2, px330-delNLS-gRNA3, and the cells were harvested after 48 hours. Centrifuge at 3000rpm for 3min, wash once with PBS, add 100μL of cell lysate RIPA, and store at -20°C for later use.
[0065] 1.2.2, Western Blot detection of Cas9 ...
Embodiment 2
[0119] Embodiment 2 obtains recombinant virus by gRNA-Cas9 cell line
[0120] 1. Method
[0121] 1.1. Establishment of cell lines stably expressing gRNA targeting the TK region
[0122] 1.1.1. Construction of Lenti-delNLS-gRNA-Cas9 plasmid
[0123] The gRNA plasmid used above does not contain the resistance gene required for cell selection and cannot be used to construct cell lines, while the Lenti-V2 plasmid contains the puromycin resistance gene and Cas9 gene, so our laboratory will use molecular cloning methods to The NLS of Cas9 in Lenti-V2 was deleted, and then three gRNA sequences targeting the TK region were introduced into Lenti-delNLS to obtain a gRNA plasmid with cytoplasmic localization of Cas9.
[0124] 1.1.2. Establishment of cell lines stably expressing gRNA-Cas9
[0125] 293T cells (5×10 5 ) were inoculated in a six-well plate without antibiotics in complete DMEM medium, cultivated overnight, and when the cell growth was 60% to 70%, the gRNA-Cas9 plasmid was...
PUM
Property | Measurement | Unit |
---|---|---|
thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap