CVA2 specific primer, real-time fluorescence detection kit and use of real-time fluorescence detection kit
A detection kit and real-time fluorescence technology, applied in the determination/inspection of microorganisms, microorganisms, recombinant DNA technology, etc., can solve problems such as increasing proportion, and achieve the effect of good specificity and good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] A real-time fluorescence detection kit for detecting Coxsackievirus type A2, the kit is composed of RT-PCR reaction solution, CVA2 strong positive control substance, CVA2 weak positive control substance, and negative quality control standard substance, wherein the RT-PCR reaction Solution contains RT-PCR buffer, fluorescent dye (TB Green), magnesium ion and deoxyribonucleotide triphosphate mixture, Ex Taq HS DNA polymerase, PrimeScript reverse transcriptase, RNase inhibitor and CVA2 specific primer, negative The quality control standard is high temperature and high pressure sterilized diethyl pyrocarbonate treated water (DEPC water), and the CVA2 strong positive control and CVA2 weak positive control are positive plasmid samples containing the conserved sequence of the VP1 gene of CVA2.
[0030] The sequences of CVA2-specific primers are as follows:
[0031] Upstream primer CVA2-F: 5'-AAAATAGTGTGGAAGAGGCTAGTATAAAC-3',
[0032] Downstream primer CVA2-R: 5'-GCACTCGTACCTG...
Embodiment 2
[0037] 1. Method
[0038] 1.1 Primers and probes
[0039] Searched from the NCBI database in the United States, downloaded multiple sequences of Coxsackievirus type A2, used MEGA4.0 software for homology comparison analysis, and finally determined that the conserved VP1 gene of the virus was used as the detection region. Using Primer Premier 5.0 software to design highly specific upstream and downstream primers in its conserved region, and after BLAST alignment, it was confirmed that the primer pair had no non-specific binding to other species (viruses). The primer sequences are as follows:
[0040] Upstream primer CVA2-F: 5'-AAAATAGTGTGGAAGAGGCTAGTATAAAC-3',
[0041] Downstream primer CVA2-R: 5'-GCACTCGTACCTGTGTCATTCAAC-3',
[0042] The conserved region gene sequence of the CVA2 standard product is as follows:
[0043] AAAATAGTGTGGAAGAGGCTAGTATAAACCACTTCTTCTCCCGAGCAGCTTTGGTTGGTAAGGTGGAGTTGAATGACACAGGTACGAGTGC
[0044] The above primers and positive control standards were...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com