Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus H3, use of bacillus H3 in preparation of collagen polypeptide through fermenting fish skin and collagen polypeptide

A technology of collagen polypeptide and bacillus, applied in the field of collagen polypeptide and its preparation, can solve the problems of complicated process, high cost, and expensive pure enzyme preparation, and achieve the effect of simple process, convenient operation, and environmental protection

Inactive Publication Date: 2019-03-19
SHANGHAI OCEAN UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a method for preparing collagen peptides from microbial fermented fish skin, which solves the problem that the process of degreasing, deodorization, decolorization and other processes in the existing collagen peptide production method is relatively complicated and the price of the pure enzyme preparation used is relatively complicated. Expensive leads to higher cost issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus H3, use of bacillus H3 in preparation of collagen polypeptide through fermenting fish skin and collagen polypeptide
  • Bacillus H3, use of bacillus H3 in preparation of collagen polypeptide through fermenting fish skin and collagen polypeptide
  • Bacillus H3, use of bacillus H3 in preparation of collagen polypeptide through fermenting fish skin and collagen polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042]Example 1: Isolation and screening of bacterial strain H3

[0043] Water samples and soil samples collected from a certain area in Shanghai were drawn into the pre-sterilized enrichment medium with 1mL or 1g, cultured in shake flasks at 160r / min and 37°C for 3 days, enriched for three times, and enriched culture medium was obtained. The collection medium is composed of fish skin and distilled water with a mass-volume ratio of 1:10 (g / mL); draw 1mL of the enrichment medium for gradient dilution, spread it on the primary screening plate, and cultivate it in a 37°C incubator for 24 hours; Bacterial colonies were streaked on plates and cultivated in an incubator at 37°C. The components of the pure medium used were: 1000 mL of distilled water, 1 g of peptone, 4 g of gelatin, 1 g of glucose, 0.5 g of dipotassium hydrogen phosphate, 0.5 g of potassium dihydrogen phosphate, and sodium chloride 5g, beef extract 5g, agar 30g. Then select a single colony for gelatin puncture and c...

Embodiment 2

[0044] Example 2: Identification of strain H3

[0045] The morphology of the high-yielding collagenase strain H3 screened by the gelatin liquefaction test in Example 1 on the solid plate of the screening medium: round, with a moist, opaque surface, irregular and slightly yellowish edges. Pick single colony wherein, carry out Gram staining, purple after Gram staining, illustrate that bacterial strain of the present invention is Gram-positive bacterium, and thalline is rod-shaped in microscope observation.

[0046] Then use the total DNA of strain H3 as a template, and use 16SrDNA universal primers for PCR amplification (16S-FAGAGTTTGATCCTGGCTCAG, 16S-RGGTTACCTTGTTACGACTT), PCR program setting: set the temperature at 94°C for 5 minutes; (set the temperature at 94°C for 30 seconds, The temperature is set at 56°C for 30 seconds and the temperature at 72°C for 1 minute) for a total of 30 cycles; the temperature at 72°C is set for 10 minutes; the temperature at 8°C is set for 30 min...

Embodiment 3

[0048] The production method of the Bacillus H3 liquid-fermented fish skin collagen polypeptide obtained through the above separation and screening is as follows: insert the Bacillus H3 into the beef extract peptone slant medium and cultivate it at 37°C for 24 hours, and then activate it, and the activated strain is inoculated into the beef extract In the peptone liquid medium, the seed solution was prepared by culturing on a shaker at 37°C and 160r / min. Then cut the dried fish skin into small pieces of about 0.5cm×0.5cm, mix the crushed fish skin with distilled water at a ratio of 1:25 (w:v), and sterilize at 121°C for 20 minutes to prepare a liquid fermentation medium; The seed solution was inoculated in the liquid fermentation medium, and fermented at 37°C and 160r / min for 32h, the obtained fermentation broth was centrifuged at 4000r / min for 30min, the supernatant was removed, impurities were removed, and the collagen polypeptide was obtained by vacuum freeze-drying for 48h....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides bacillus H3, use of bacillus H3 in the preparation of collagen polypeptide from fermenting fish skin and collagen polypeptide. The preservation number of bacillus H3 is CGMCC NO:15830, and bacillus H3 can be separated from soil; a seed solution is prepared by virtue of bacillus H3, a fermentation culture medium is prepared through crushing the fish skin, and the collagen polypeptide is prepared through sequential bacteria grafting fermentation, fermentation liquid centrifugation, rotary evaporation fermentation and vacuum freeze drying; and the prepared collagen polypeptide preserves a complete three-screw structure and has good solubility, emulsifying property and stability. Compared with an existing preparation method of collagen polypeptide, the preparation methodhas the advantages that the process is simple, the operation is convenient, use of a large quantity of chemical regents is avoided, the environmental protection is promoted, and the extracted collagen polypeptide is relatively small in molecular weight and easy to absorb and can be applied to the fields of foods, cosmetics and health products.

Description

technical field [0001] The invention belongs to the technical field of collagen polypeptide preparation, and in particular relates to a microbial strain bacillus H3 and the use of the strain to prepare collagen polypeptide by fermenting fish skin, and also relates to collagen polypeptide and a preparation method thereof. Background technique [0002] Collagen is a white, opaque, unbranched fibrous protein, which is the main component of the extracellular matrix and the main component of animal connective tissue. It mainly exists in animal skin, bone, cartilage, teeth, tendons, and ligaments. It is the most abundant and widely distributed functional protein in mammals. Collagen is rich in sources and nutrients, and its structure and functional properties are diverse and complex. It can play a role in biopharmaceuticals, medical care, cosmetics, tissue engineering, food industry and other fields, and has a good application prospect. [0003] However, due to its large molecula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C07K14/78C12P21/02C12R1/07
CPCC12N1/20C12P21/02C07K14/78C12R2001/07C12N1/205
Inventor 李晓晖韩玮刑瀚文施文正钟建
Owner SHANGHAI OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com