Bacillus H3, use of bacillus H3 in preparation of collagen polypeptide through fermenting fish skin and collagen polypeptide
A technology of collagen polypeptide and bacillus, applied in the field of collagen polypeptide and its preparation, can solve the problems of complicated process, high cost, and expensive pure enzyme preparation, and achieve the effect of simple process, convenient operation, and environmental protection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042]Example 1: Isolation and screening of bacterial strain H3
[0043] Water samples and soil samples collected from a certain area in Shanghai were drawn into the pre-sterilized enrichment medium with 1mL or 1g, cultured in shake flasks at 160r / min and 37°C for 3 days, enriched for three times, and enriched culture medium was obtained. The collection medium is composed of fish skin and distilled water with a mass-volume ratio of 1:10 (g / mL); draw 1mL of the enrichment medium for gradient dilution, spread it on the primary screening plate, and cultivate it in a 37°C incubator for 24 hours; Bacterial colonies were streaked on plates and cultivated in an incubator at 37°C. The components of the pure medium used were: 1000 mL of distilled water, 1 g of peptone, 4 g of gelatin, 1 g of glucose, 0.5 g of dipotassium hydrogen phosphate, 0.5 g of potassium dihydrogen phosphate, and sodium chloride 5g, beef extract 5g, agar 30g. Then select a single colony for gelatin puncture and c...
Embodiment 2
[0044] Example 2: Identification of strain H3
[0045] The morphology of the high-yielding collagenase strain H3 screened by the gelatin liquefaction test in Example 1 on the solid plate of the screening medium: round, with a moist, opaque surface, irregular and slightly yellowish edges. Pick single colony wherein, carry out Gram staining, purple after Gram staining, illustrate that bacterial strain of the present invention is Gram-positive bacterium, and thalline is rod-shaped in microscope observation.
[0046] Then use the total DNA of strain H3 as a template, and use 16SrDNA universal primers for PCR amplification (16S-FAGAGTTTGATCCTGGCTCAG, 16S-RGGTTACCTTGTTACGACTT), PCR program setting: set the temperature at 94°C for 5 minutes; (set the temperature at 94°C for 30 seconds, The temperature is set at 56°C for 30 seconds and the temperature at 72°C for 1 minute) for a total of 30 cycles; the temperature at 72°C is set for 10 minutes; the temperature at 8°C is set for 30 min...
Embodiment 3
[0048] The production method of the Bacillus H3 liquid-fermented fish skin collagen polypeptide obtained through the above separation and screening is as follows: insert the Bacillus H3 into the beef extract peptone slant medium and cultivate it at 37°C for 24 hours, and then activate it, and the activated strain is inoculated into the beef extract In the peptone liquid medium, the seed solution was prepared by culturing on a shaker at 37°C and 160r / min. Then cut the dried fish skin into small pieces of about 0.5cm×0.5cm, mix the crushed fish skin with distilled water at a ratio of 1:25 (w:v), and sterilize at 121°C for 20 minutes to prepare a liquid fermentation medium; The seed solution was inoculated in the liquid fermentation medium, and fermented at 37°C and 160r / min for 32h, the obtained fermentation broth was centrifuged at 4000r / min for 30min, the supernatant was removed, impurities were removed, and the collagen polypeptide was obtained by vacuum freeze-drying for 48h....
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com