Primer probe group and kit for combined detection of Batai virus and Taina virus based on dual fluorescence PCR method
A technology of Batay virus and primer probe, which is applied in the field of primer-probe group for joint detection of Batay virus and Tyna virus based on dual fluorescent PCR method, can solve the problems of lack of effective detection methods for Batay virus and Tyna virus
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Design and synthesis of primers and probes for the dual detection kit (fluorescence PCR method) of Batay virus and Taina virus:
[0033] According to SEQ ID No.1-6, synthesize the specific primers of Batai virus, the Batai virus probe, the specific primers for Taina virus and the Taina virus probe, and label FAM at the 5' of Batay virus probe The fluorophore, the 5'-labeled HEX fluorescent group of the Tyna virus probe, and the 3' end of both are labeled with BHQ1, and the primer probes for Batay virus and Tyna virus are synthesized. The primers and probe sequences are as follows:
[0034] Batay virus:
[0035] Upstream primer: ATTAACTTTAAGCGTATCTA (SEQ ID No.1)
[0036] Downstream primer: GTATTAAATACAGTAACCTTC (SEQ ID No.2)
[0037] Probe: 5'FAM-TTAGTTATGACAACATTAGAATCTT-BHQ13' (SEQ ID No.5)
[0038] Tynavirus:
[0039] Upstream primer: TATGATAAATACTATGAACTAAC (SEQ ID No.3)
[0040] Downstream primer: AATCTATTGGAGCTAATATG (SEQ ID No.4)
[0041] Probe: 5'HEX-ATCTATT...
Embodiment 2
[0043] Preparation of detection mixture of Batay virus and Taina virus dual nucleic acid detection kit (fluorescent PCR method):
[0044] According to Batai virus upstream primer 0.5μl / test; downstream primer 0.5μl / test; probe 0.25μl / test; Taina virus upstream primer 0.5μl / test; downstream primer 0.5μl / test; probe 0.25μl / test; primer The concentration is 10μM, and the probe concentration is 10μM; PCR MIX 12.5μl / test; process water (ddH 2 O) Mix at 5 μl / test to obtain the nucleic acid fluorescent PCR detection mixture.
Embodiment 3
[0046] Sensitivity analysis of Batai virus and Taina virus dual nucleic acid detection kit (fluorescent PCR method):
[0047] 3.1 Sample preparation:
[0048] Take 1×10 9 Copies / ml of Batai virus plasmid (BATV-S1) (the BATV-S1 plasmid obtained by cloning the target amplified sequence into the PEGM-T vector by TA. The target amplified sequence is:
[0049] ATTAACTTTAAGCGTATCTACACCACTGGGCTTAGTTATGACAACATTAGAATCTTCTACATTAAAGGACGCGAGATTAAAACTAGTCTCGCAAAAAGAGTGAATGGGAGGTTACGCTTAACCTTGGGGGCTGGAAGGTTACTGTATTTAATAC (SEQ ID No. 7)) was divided into 5 parts, and 4 parts were diluted according to 10 times, 100 times, 1000 times, 10000 times to obtain BA0 TV 8 copies / ml), BATV-S3 (1×10 7 copies / ml), BATV-S4 (1×10 6 copies / ml), BATV-S5 (1×10 5 copies / ml), a total of 5 copies were obtained as test samples.
[0050] Take 1×10 9 Copies / ml Taina virus plasmid (TAHV-S1) (the TAHV-S1 plasmid obtained by cloning the target amplification sequence into the PEGM-T vector by TA. The target ampl...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com