Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tobacco chloride ion channel protein NtCLC2 and application thereof

A chloride ion channel and chloride ion technology, applied in the field of tobacco genetic engineering, can solve the problems of poor industrial practicability of tobacco leaf quality, lack of good practicability and the like

Inactive Publication Date: 2018-11-20
ZHENGZHOU TOBACCO RES INST OF CNTC
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But in general, these measures have not fundamentally changed the situation that these tobacco leaves are low in quality and not strong in industrial practicability
Therefore, the relevant improvement measures lack good practicability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco chloride ion channel protein NtCLC2 and application thereof
  • Tobacco chloride ion channel protein NtCLC2 and application thereof
  • Tobacco chloride ion channel protein NtCLC2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] This example mainly focuses on tobacco chloride channel protein NtCLC2 The process of obtaining genes is briefly introduced as follows.

[0049] Take cultivated tobacco leaves as samples, use RNA extraction kit to extract total RNA from tobacco leaves, and reverse transcription into cDNA for use;

[0050] By homology comparison method, refer to Arabidopsis thaliana AtCLC2 The sequence of the gene and the known partial gene sequence of tobacco, the sequence of the designed amplification primer is as follows:

[0051] F: 5’- CGCGAGCTCGGTACCATGGAAGATCAAGGTGAT -3’,

[0052] R: 5’- GCTCACCATGGATCCCTTGTGATGGACCAAAT -3’;

[0053] Using the cDNA prepared above as a template, PCR amplification was performed using the above primers.

[0054] The PCR reaction system is:

[0055] 1μL of upstream primer,

[0056] 1μL of downstream primer,

[0057] cDNA 1μL,

[0058] 10×buffer 5μL,

[0059] dNTP 6μL,

[0060] EazyTaq enzyme 1μL,

[0061] Add ddH 2 O to 50μL.

[0062] PCR reaction program: 94°C pre-den...

Embodiment 2

[0071] For sure NtCLC2 The function of genes in tobacco, selection NtCLC2 The specific nucleic acid fragment in the gene (the 1426th-1738th nucleotide sequence of SEQ IDNO.1 in the sequence table) was used as the guide sequence to construct the silence NtCLC2 Transgenic plants were constructed by using VIGS vector for transient silencing of genes and further transformed tobacco plants. The relevant experimental procedures are briefly introduced as follows.

[0072] (1) Construction of VIGS vector for transient silence

[0073] First, design the primer sequences for PCR amplification as follows:

[0074] NtCLC2 -F: 5’- CGACGACAAGACCCTCTTGGCGTCGTTACTTAT-3’,

[0075] NtCLC2 -R: 5’- GAGGAGAAGAGCCCTTTCACAATCTGGTCATAG-3’;

[0076] Carry out PCR amplification (amplification length: 312bp) with the above primer sequence to obtain VIGS guide sequence;

[0077] Secondly, use the In-Fusion method to connect the amplified guide sequence to the TRV vector (connected at 50°C for 15 minutes), screen an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of tobacco genetic engineering and specifically relates to a tobacco chloride ion channel protein NtCLC2 and application thereof. A gene CDS sequence comprises a 2343bp basic group; and the sequence of the basic group of the gene CDS sequence is as shown in SEQ ID NO. 1, wherein 1426th-1738th nucleotides are specific nucleotide fragments. The tobacco chloride ion channel protein NtCLC2 is a key protein metabolized by tobacco chloride ions; by using a virus induced gene silencing (VIGS) technology, the content of the chloride ions in a transgene silencing plant is obviously reduced after NtCLC2 gene expression is inhibited. Based on this, a good foundation can be laid for culturing a new variety of low chlorine content tobacco; and meanwhile, a fundamental technical support is provided for stabilizing tobacco leaf quality and improving cigarette quality.

Description

Technical field [0001] The invention belongs to the technical field of tobacco genetic engineering, and specifically relates to a tobacco chloride channel protein NtCLC2 and its application patent application. Background technique [0002] Existing studies on tobacco generally believe that the content of chloride ions in tobacco leaves should be 0.3 to 0.8. When the content reaches 1%, it will affect the smoldering and fire retention. When the content is higher than 1%, black ash flameout will occur; On the one hand, when the chloride ion content in the tobacco leaves is too high, it will cause the accumulation of starch, the leaves are thick and brittle, and the hygroscopicity is large, which makes the color darker during storage and produces bad odor. In short, the chloride ion content in tobacco leaves has a more important direct impact on the quality of tobacco leaves. [0003] Based on the direct impact of the chloride ion content in tobacco leaves on tobacco quality and its ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/66C12N15/82A01H5/00A01H6/82
CPCC07K14/415C12N15/8251C12N15/8261
Inventor 张慧徐国云金立锋周会娜翟妞刘萍萍陈千思郑庆霞陈霞
Owner ZHENGZHOU TOBACCO RES INST OF CNTC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com