Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Umbilical cord mesenchymal stem cells modified by NTF4 (neurotrophin 4) gene and construction method and application thereof

A technology of NTF4 and mesenchymal stem cells, applied in the field of stem cells, can solve problems such as threats to human health and residual paralysis, and achieve the effect of strong combination, promotion of cell regeneration and repair, and protection of nerve cells

Inactive Publication Date: 2018-11-06
江苏禄亿生生物科技有限公司
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, clinical treatment of ischemic stroke at home and abroad mainly adopts measures such as ultra-early thrombolysis and brain nerve protection, but most patients are left with severe disabilities such as paralysis and aphasia due to failure of timely thrombolysis beyond the 3-hour time window, which seriously threatens human health.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Umbilical cord mesenchymal stem cells modified by NTF4 (neurotrophin 4) gene and construction method and application thereof
  • Umbilical cord mesenchymal stem cells modified by NTF4 (neurotrophin 4) gene and construction method and application thereof
  • Umbilical cord mesenchymal stem cells modified by NTF4 (neurotrophin 4) gene and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] The construction of embodiment 1NTF4 gene recombination plasmid vector

[0062] (1) Obtain NTF4 gene by PCR

[0063] Using the pcDNA3.0-NTF4-Flag plasmid as a template, the complete sequence of NTF4 coding was amplified with primers F: 5'CGGAATTCCGATGGAGGGAGAGG 3' and R: 5'CGGGATCCCGTCAGGCCCGGCC 3'. The PCR reaction parameters were: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 1 min, and incubation at 10°C. The product was identified and separated by 1% agarose gel electrophoresis, and the NTF4 amplified fragment was recovered and purified using a DNA gel recovery kit. The target fragment size was about 633bp. Among them, the pcDNA3.0-NTF4-Flag plasmid was preserved by the laboratory, the agarose and DNA marker were purchased from Beijing Quanshijin Biological Company, and the DNA polymerase used in PCR amplification was KOD high-fidelity polymerase, which wa...

Embodiment 3

[0071] The construction of the umbilical cord mesenchymal stem cell of embodiment 3NTF4 gene modification

[0072] Take P2 generation human umbilical cord mesenchymal stem cells from liquid nitrogen, resuscitate, use 6cm culture dish to subculture and plate, when the human umbilical cord mesenchymal stem cells grow to 70% cell confluence, absorb the culture medium in the culture dish, add CD513B vector respectively Add 1 mL of lentivirus venom and CD513B-NTF4 lentivirus venom and an equal volume of culture medium, and add polybrene at the same time. 2 cultured overnight in a cell culture incubator. After 24 hours, the infection solution was discarded and fresh complete medium was replaced to continue the culture. The lentiviral transfection efficiency was detected by a fluorescence microscope. After 48 hours, hU-MSCs were observed to emit green fluorescence under a fluorescence microscope, indicating that the infection was successful. The final concentration of puromycin was ...

Embodiment 4

[0074] Example 4 Western blot detection method to detect the expression of NTF4 in NTF4 gene-modified umbilical cord mesenchymal stem cells

[0075] The total protein in the NTF4 / hUC-MSCs cell line stably expressing NTF4 and the blank modified BV / hUC-MSCs cell line were extracted respectively, and the protein concentration of the extracted protein was determined by the BCA method. Acrylamide gel electrophoresis. After electrophoresis, the protein on the gel was transferred to PVDF membrane by electrophoresis, and the mass fraction was 5% skimmed milk powder, which was blocked at room temperature for 2 hours. Incubate rabbit anti-human NTF4 antibody (1:1000 dilution) and internal reference rabbit respectively. Anti-human β-tubulin antibody (diluted 1:5000), incubated overnight at 4°C, washed PVDF membrane with PBST shaker (3 times, 5min each), incubated HRP-labeled goat anti-rabbit antibody (diluted 1:2000) at room temperature for 2h, Wash the PVDF membrane with PBST shaker (3 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of stem cells and particularly relates to umbilical cord mesenchymal stem cells modified by NTF4 (neurotrophin 4) gene and a construction method and application thereof. The umbilical cord mesenchymal stem cells modified by NTF4 gene are provided herein and can overexpress NTF4 protein. The umbilical cord mesenchymal stem cells modified by NTF4 gene canreplace damaged nerve cells, can well express NTF4 protein to arrive at nerve cell protection and promote cell regeneration and restoration, can be a treatment carrier having great potential of targeting therapy for cerebral arterial thrombosis, and can gain enhanced action of hUC-MSCs so that powerful combination is achieved. Experimental results show that the umbilical cord mesenchymal stem cells modified by NTF4 gene can be applied to model rats with focal cerebral ischemia to effectively repair brain damage of the rats.

Description

technical field [0001] The invention belongs to the technical field of stem cells, and in particular relates to an NTF4 gene-modified umbilical cord mesenchymal stem cell and its construction method and application. Background technique [0002] Ischemic stroke is a common cardiovascular and cerebrovascular disease. Ischemic stroke refers to cerebrovascular disease or systemic disease that leads to partial or complete supply of cerebral blood flow. Ischemia and hypoxia cause brain tissue necrosis and liquefaction. A large class of diseases in which dysfunction occurs and corresponding neurological symptoms and signs appear. The main types include focal cerebral infarction and global cerebral ischemic injury. At present, the clinical treatment of ischemic stroke at home and abroad mainly adopts measures such as ultra-early thrombolysis and cranial nerve protection. However, most patients are left with severe disabilities such as paralysis and aphasia due to failure of timely...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/867A61K35/28A61P9/10A61P9/00
CPCA61K35/28A61P9/00A61P9/10C12N5/0665C12N15/86C12N2500/32C12N2501/998C12N2510/02C12N2740/15043
Inventor 李陶吴爽陈玉华
Owner 江苏禄亿生生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com