Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

IOT (internet of things) anti-counterfeiting traceability system for rapid identification of donkey-hide gelatin DNA (deoxyribonucleic acid) and anti-counterfeiting traceability method

A technology of the Internet of Things and DNA chips, applied in biochemical equipment and methods, transmission systems, bioreactors/fermenters for specific purposes, etc., to achieve the effects of copy control and good anti-counterfeiting means

Inactive Publication Date: 2018-10-12
亳州中药材商品交易中心有限公司
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Other logos, such as medicine logos include Chinese herbal medicine logos, prescription drug logos, imported drug logos, special management drug logos, and national essential drug logos, but the codes can be easily copied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IOT (internet of things) anti-counterfeiting traceability system for rapid identification of donkey-hide gelatin DNA (deoxyribonucleic acid) and anti-counterfeiting traceability method
  • IOT (internet of things) anti-counterfeiting traceability system for rapid identification of donkey-hide gelatin DNA (deoxyribonucleic acid) and anti-counterfeiting traceability method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Prepare the DNA chip, the specific process is as follows:

[0048] 1. Attach a layer of 150nm metal film on the surface of the silicon chip through the metal coating process, which can be Au or Ag;

[0049] 2. Thiolate the probe gene fragment, and then point different thiolated probes to different regions, and keep it at 4°C for 12 hours, including according to donkey, pig, cow, sheep, horse,

[0050] Rabbit gene designed probes:

[0051] donkey,AACGTAGGTCTGACGTGACTCCCCGA;

[0052] Pig, CCTATATACCGCCATCTTC;

[0053] Cow, GAGGAGCCTGTTCCGTAATCGAT;

[0054] Sheep, TCAAGCACACTACAAAGTATCGC;

[0055] horse, GTAAATTAAGAAAGAGAGCTTAATT;

[0056] Rabbit, ACACCTTGCTAGGCCACACCCACGGG.

[0057] 3. Then wash off unbound probes on the surface of the metal film with deionized water, and then blow dry with nitrogen.

[0058] The DNA chip prepared by the above method has good stability and can be circulated in the market for a long time. The DNA probes on the surface are designed f...

Embodiment 2

[0060] Construct the donkey-hide gelatin DNA database, the specific process is as follows:

[0061] 1. Extract genuine donkey-hide gelatin samples through the silica bead method, the specific process is as follows:

[0062] (a) Add 4ml of CTAB extract and 80ul of mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take a sample of donkey-hide gelatin, crush it into powder, transfer it to the preheated centrifuge tube, seal it, and heat it at 65°C. Incubate in a water bath at ±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, add 4ml of chloroform-isoamyl alcohol mixed solution, mix well, and form a mixed emulsion;

[0063] (b) Add 100ul of silica bead suspension to the mixed emulsion, mix well, let stand for 10 minutes, centrifuge at 8000rpm15s at 4 degrees, remove the supernatant, and wash the precipitate twice with 1ml washing liquid and twice with 1ml ice ethanol, Dry at 60°C for 5 minutes;

[0064] (c) A...

Embodiment 3

[0071] To check the validity of the DNA chip and Ejiao DNA database, the inspectors do not know the authenticity of the tested Ejiao samples:

[0072] 1. The tested donkey-hide gelatin sample was extracted by the silica bead method, and the specific process was as follows:

[0073] (a) Add 4ml of CTAB extract and 80ul of mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take a sample of donkey-hide gelatin, crush it into powder, transfer it to the preheated centrifuge tube, seal it, and heat it at 65°C. Incubate in a water bath at ±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, add 4ml of chloroform-isoamyl alcohol (24:1) mixed solution, mix well, and form a mixed emulsion;

[0074] (b) Add 100ul silica bead suspension to the mixed emulsion, mix well, let it stand for 10 minutes, centrifuge at 8000rpm 15s at 4 degrees, remove the supernatant, and wash the precipitate twice with 1ml washing liquid and twic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of anti-counterfeiting authentication of donkey-hide gelatin, and concretely relates to an IOT (internet of things) anti-counterfeiting traceability system for rapididentification of donkey-hide gelatin DNA (deoxyribonucleic acid) and anti-counterfeiting traceability method thereof. The traceability system comprises a cloud, a DNA chip, an identification device,a traceability label, a DNA retrieval terminal and traceability retrieval terminal, wherein the DNA chip and the traceability label are adopted by a donkey-hide gelatin DNA IOT anti-counterfeiting system, and the parts, which have biological detection experiment capacity, can be used for rapidly detecting through the DNA chip and distinguishing the true from the false through a DNA big data analysis so as to carry out anti-counterfeiting. The parts, which do not have biological detection experiment capacity, can be used for tracing through the traceability label to look over information of donkey-hide gelatin production, processing, storage, transaction, logistics, terminal and detection, and the cloud can be used for analyzing whether abnormality exists or not and sending an analysis result to an inquirer. The data inquired by the traceability label can change with time and space through big data, and even if the same traceability label is duplicated, the abnormal inquiry situation can also be discovered by the system. The effective control of duplication performed by a counterfeiter is realized, and a better anti-counterfeiting means is formed.

Description

technical field [0001] The invention belongs to the field of identification and anti-counterfeiting of donkey-hide gelatin, and in particular relates to an anti-counterfeiting traceability system and an anti-counterfeit traceability method for rapid identification of donkey-hide gelatin DNA in the Internet of Things. Background technique [0002] Donkey-hide gelatin (Asini Corii Colla) is a solid glue made from the dry skin or fresh skin of the equine animal donkey Equus asinus L. after decoction and concentration. "Jing", listed as the top grade, Tao Hongjing said: "from Dong'e, hence the name donkey-hide gelatin". Donkey-hide gelatin is sweet in taste and flat in nature, and belongs to the lung, liver and kidney meridians. It has the effects of nourishing blood, nourishing yin, moistening dryness, and stopping bleeding, and has been honored as the "sacred medicine" for nourishing blood by physicians of all dynasties. Indications for blood deficiency and chlorosis, dizzin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/21C12M1/34C12M1/00G06Q30/00G06K17/00H04L29/08
CPCG01N21/21C12Q1/6806C12Q1/6837G06K17/0022G06Q30/0185H04L67/12C12Q2563/149
Inventor 怀化
Owner 亳州中药材商品交易中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com