A type A Seneca virus virus-like particle and its preparation method and application
A virus-like, virus technology, applied in positive-sense single-stranded RNA viruses, biochemical equipment and methods, viruses, etc., can solve problems such as non-infectivity, and achieve the effect of improving assembly efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] The preparation of embodiment 1SVA virus-like particle
[0054] 1. Construction of small ubiquitin-like modified protein fusion expression vectors pSMA, pSMK and pSMC:
[0055] (1) Using Saccharomyces cerevisiae genomic DNA as a template and using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:
[0056] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3'
[0057] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3',
[0058] (2) After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with ampicillin resistance Gene or chloramphenicol resistance gene, get vector pSMA and pSMC;
[0059] 2. Construction of SVA structural protein gene recombinant expression vector
[0060] According to the published SVA sequence (GenBank accession number: NC_011349), the codons wer...
Embodiment 2
[0085] The immunogenicity research of embodiment 2SVA virus-like particles
[0086]The antigen for immunization was emulsified with Freund's adjuvant according to the instructions. Fifteen guinea pigs weighing about 300 grams were randomly divided into 3 groups. The first group was immunized with VLPs (prepared in Example 1), the second group was immunized with unassembled proteins, and the third group was injected with PBS as a control. Blood was collected 28 days after immunization to separate serum, and antibody titers and neutralizing antibodies were detected.
[0087] (1) ELISA detection of antibody titer
[0088] A 96-well ELISA plate was coated overnight at 4° C. with 100 μL of SVA hyperimmune serum diluted in 0.05 M sodium carbonate buffer (pH 9.6). Wash with PBST for 3 times, then incubate with SVA virus solution at 37°C for 1 h, wash with PBST for 3 times, and block the well plate with PBST (100 μL) containing 5% skimmed milk powder at 37°C for 1 h. After washing ...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap