Primer pair, kit containing same, use and method for detecting ecotypes a17 and r108 of Medicago truncatula
An R108, eco-type technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of loss of gene function research of Medicago truncatula, inaccurate results, and difficulty in distinguishing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1 A kind of primer pair that detects Medicago truncatula ecotype A17 and R108
[0054] The present embodiment provides a detection of Medicago truncatula ecotypes A17 and R108, the primer pair includes primer NST480-F and primer NST480-R, wherein, primer NST480-F has the sequence shown in SEQ ID NO.1, and primer NST480- R has the sequence shown in SEQ ID NO.2.
[0055] NST480-F (5′-3′): GGAGAACAATGAGAACAACAATG
[0056] NST480-R (5'-3'): GACCACCATCACCACATGC
Embodiment 2
[0057] Example 2 A test kit for detecting Medicago truncatula ecotypes A17 and R108
[0058] This embodiment provides a test kit for detecting Medicago truncatula ecotypes A17 and R108, which includes the following components: primer NST480-F and primer NST480-R, 2×PCR Master and ddH 2 O;
[0059] 2×PCR Master contains 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer.
Embodiment 3
[0060] Embodiment 3 A kind of method for distinguishing the seeds of Medicago truncatula ecotype A17 and R108
[0061] The present embodiment provides a kind of method of identifying the seed of Medicago truncatula ecotype A17 and R108, and the method comprises the steps:
[0062] A) Collect the seeds of different mutant types of Medicago truncatula ecotypes A17 and R108, adopt the double-layer filter paper germination method, germinate at 25°C for 72 hours, and extract the genomic DNA of the germinated seeds by the SDS method for future use;
[0063] B) using primer NST480-F and primer NST480-R to perform PCR amplification on the genomic DNA extracted in step A);
[0064] The PCR amplification system is a 20 μl system, including 10 μl of TaKaRa 2×PCR TaqMix, 1 μl of DNA template with a concentration of 50 ng / μl, 1 μl of primer NST480-F with a concentration of 10 nM, 1 μl of primer NST480-R with a concentration of 10 nM and ddH 2 O 7 μl;
[0065] PCR amplification program: a) ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com