Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of quality detection method of dendrobium nobile

A quality inspection method and technology of Dendrobium dendrobii are applied in the directions of measuring devices, instruments, scientific instruments, etc., which can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, solve the dimensional disaster, and effectively identify and quality control

Active Publication Date: 2021-03-16
北京蓝标一成科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of quality detection method of dendrobium nobile
  • A kind of quality detection method of dendrobium nobile
  • A kind of quality detection method of dendrobium nobile

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Generation Sequencing of Dendrobium officinale

[0053] First-generation sequencing primer sequences:

[0054] ITS-26SE: 5' GAATTCCCCCGGTTCGCTCGCCGTTAC 3';

[0055] ITS-17SE: 5'ACGAATTCATGGTCCGGTGAAGTGTTCG 3'.

[0056] Amplification and sequencing parameters were: 98°C for 2 min, followed by PCR cycle, the PCR cycle parameters were 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min, set 4°C for incubation after amplification, and proceed Next-Generation Molecular Sequencing.

[0057] Through next-generation sequencing, the species of Dendrobium to be tested was identified as Dendrobium doulip.

Embodiment 2

[0058] The extraction method of embodiment 2 Dendrobium purpurea

[0059] Take a dry sample of Dendrobium dendrobii, pulverize it with a pulverizer, pass through a pharmacopoeia sieve (pore size 0.335mm), accurately weigh 1.000g of Dendrobium Dendrobium powder (the weighing error cannot exceed 0.2%), place it in a 100ml conical flask, and add 50mL 75 % methanol (V water:V methanol=25:75), take out after sonicating for 30min at room temperature, filter, and concentrate the filtrate to dryness by rotary evaporation, dissolve with 75% methanol solvent (V water:V methanol=25:75), and finally transfer Dilute to a volume of 10ml in a volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium pauli.

Embodiment 3

[0060] Embodiment 3 The chromatographic detection method of Dendrobium officinale extract

[0061] ①Preparation of reference solution

[0062] Precisely weigh 4.10 mg of schavertoside and 4.08 mg of naringenin, respectively, place them in a 10 ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, and shake well to serve as a stock solution. Store in a 4°C refrigerator for later use.

[0063] Then, a certain amount of the reference substance stock solution was precisely drawn, and diluted with 75% methanol to accurately prepare a mixed reference substance solution of schafftoside and naringenin. Through different dilution ratios, 7 concentration points of the prepared ingredients are diluted. Inject into the high performance liquid chromatograph.

[0064] ②Extraction and processing method of samples for the determination of the content of small molecular components of Dendrobium officinale:

[0065] Take 1.00g of this product powder (passed through a No. 3 sie...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a quality detecting method of Dendrobium aphyllum. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the variety of ato-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and / or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium aphyllum; and 4) establishing an analysis model by using the content value of the schaftoside and / or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint asthe independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. According to the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium aphyllum is precisely identified and controlled.

Description

technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine ingredients, and particularly relates to a quality detection method of Dendrobium officinale. Background technique [0002] Dendrobium aphyllum (scientific name: Dendrobium aphyllum (Roxb.) C.Fischer): also known as Tiangong Dendrobium. Stems drooping, fleshy, slender cylindrical, 30cm-60cm long, 0.4cm-0.7cm in diameter, unbranched, with many nodes, internodes 2cm-3.5cm long; leaf base with sheath, leaf sheath papery, pale white when dry , the sheath mouth is cup-shaped opening. Racemes almost without inflorescence rachis, each 1 to 3 in a bundle, emanating from the upper part of deciduous old stems or leafy old stems; inflorescence peduncle is about 0.2 cm to 0.5 cm long, and the base is covered with 3 to 4 sheaths ; membranous, 0.2cm-0.3cm long; flower bracts pale white, membranous, ovate, about 0.3cm long, apex acute; pedicel and ovary dark brown with gree...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N30/06G01N30/86
CPCG01N30/06G01N30/8686
Inventor 赵田
Owner 北京蓝标一成科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com