Supercharge Your Innovation With Domain-Expert AI Agents!

RPA kit used for detecting Cyprinid herpesvirus II, and special primer and probe thereof

A carp herpes virus and kit technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as complex reaction principles, unfavorable sequencing construction, and uneven reaction products

Pending Publication Date: 2018-06-01
SHANGHAI OCEAN UNIV
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The conventional detection technology of CyHV-II, such as LAMP technology, has complex reaction principles and cumbersome primer design, and the conservative segment required for the target sequence is relatively strict when designing primers, and the reaction products are not uniform, which is not conducive to the later sequencing and construction of clones. Therefore, it has not been widely used; PCR technology is time-consuming, expensive, and requires sophisticated temperature cycle instruments, which severely limits the application of PCR technology in on-site detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA kit used for detecting Cyprinid herpesvirus II, and special primer and probe thereof
  • RPA kit used for detecting Cyprinid herpesvirus II, and special primer and probe thereof
  • RPA kit used for detecting Cyprinid herpesvirus II, and special primer and probe thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Design and screening of RPA-specific primers and probes for detecting type II carp herpesviruses

[0027] In this example, Shanghai Biological Engineering Co., Ltd. was entrusted to design specific primer sequences and probe sequences for CyHV-II target genes, by designing a series of gradient candidate primers in the conserved gene region, and selecting the best primers based on the RPA gel detection results. in:

[0028] The forward primer sequence of the RPA specific primer is

[0029] CAATCAGGGTCAGTGGACGAGACTGGCGTTGT;

[0030] The reverse primer sequence of the RPA specific primer is

[0031] CCTCCCAGAGCCATGTTACCCGGTCTGAAGGA;

[0032] The probe sequence is:

[0033] (FAM)cactctggcgacgcgtttgtggttgaaccgccaTc(THF)gTggaggcttcaaaggc(C3spacer).

Embodiment 2

[0034] The agarose gel analysis of embodiment 2 reaction product

[0035]First extract CyHV-II virus according to the following steps: (1) add and add sample PBS buffer and mix evenly, centrifuge at 8000rpm for 5min, discard the supernatant; (2) add 1ml buffer and 20μL protease and incubate in a 56°C water bath for 3h; (3) Centrifuge at 8000rpm for 5min, take 750μL supernatant and put it in a new centrifuge tube, add phenol: chloroform: isoamyl alcohol with a volume ratio of 25:24:1, mix at 50rpm for 10min, then centrifuge at 8000rpm for 5min, Take 650 μL of supernatant in a new centrifuge tube, repeat the above operation and ensure that the protein layer is not sucked; (4) Take 600 μL of supernatant in a new centrifuge tube, add chloroform:isoamyl alcohol at a volume ratio of 24:1 Mix at a speed of 50 rpm for 10 minutes, then centrifuge at 8000 rpm for 5 minutes; (5) Take 480 μL of the supernatant in a new centrifuge tube, add 40 μL of 3 mol / L sodium acetate and 960 μL of 4°C...

Embodiment 3

[0037] The test strip analysis of embodiment 3 reaction products

[0038] The extraction of CyHV-II virus is the same as in Example 2, and the PCR amplification reaction is carried out according to the following composition and proportioning reaction system, wherein, 2.1 μl of upstream primers, 2.1 μl of downstream primers, 0.6 μl of fluorescent probes, 29.5 μl of RehydrationBuffer, and 2 μl of viral DNA , ddH 2 O11.2 μl, the total amount is 47.5 μl. The reaction steps of RPA test strip detection are as follows: ①Mix the above components, shake slightly and centrifuge for several seconds; ②Put the mixture into a 0.2mL Twist Amp Basic reaction tube containing lyophilized enzyme powder and aspirate several times; ③Add 2.5μL of 280mM Repeated absorption of magnesium acetate several times; ④ Put it in a metal incubator at 38°C for 4 minutes, take it out and mix well, and then put it in a metal incubator at 38°C for 36 minutes; figure 2 shown. When there are two bands on the te...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a RPA kit used for detecting Cyprinid herpesvirus II, and a special primer and a probe thereof. The forward primer sequence of the RPA special primer is CAATCAGGGTCAGTGGACGAGACTGGCGTTGT, and the reverse primer sequence is CCTCCCAGAGCCATGTTACCCGGTCTGAAGGA; the probe sequence is (FAM)cactctggcgacgcgtttgtggttgaaccgccaTc(THF)gTggaggcttcaaaggc(C3spacer). The kit containing the above RPA special primer and the probe can be used for visualization detection of Cyprinid herpesvirus II in 15min at 37 DEG C constant temperature conditions.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a detection technology for type II cyprinurpesvirus, in particular to an RPA kit for detecting type II cyprinary herpesvirus, special primers and probes thereof, and an application in detecting type II cyprinary herpesvirus. Background technique [0002] From 2009 to 2010, crucian carp "viral hemorrhagic disease" occurred sporadically in crucian carp breeding ponds in Sheyang County, northern Jiangsu Province, causing the death of crucian carp in affected ponds. In August-September 2011, a large-scale outbreak occurred in Yancheng area and caused A large number of deaths occurred. In March 2012, a small number of crucian carp ponds were found to be sick. In June, a large-scale outbreak occurred. In Sheyang County, the disease occurred in 80% of the ponds. The "viral hemorrhagic disease" of crucian carp was identified as Crucian Carp Hematopoietic Necrosis, and its pathogen was Cyprinid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/705C12Q2521/507C12Q2522/101C12Q2545/114C12Q2531/113
Inventor 吕利群王浩孙萌姜有声许丹余琳
Owner SHANGHAI OCEAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More