RPA kit used for detecting Cyprinid herpesvirus II, and special primer and probe thereof
A carp herpes virus and kit technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems such as complex reaction principles, unfavorable sequencing construction, and uneven reaction products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Design and screening of RPA-specific primers and probes for detecting type II carp herpesviruses
[0027] In this example, Shanghai Biological Engineering Co., Ltd. was entrusted to design specific primer sequences and probe sequences for CyHV-II target genes, by designing a series of gradient candidate primers in the conserved gene region, and selecting the best primers based on the RPA gel detection results. in:
[0028] The forward primer sequence of the RPA specific primer is
[0029] CAATCAGGGTCAGTGGACGAGACTGGCGTTGT;
[0030] The reverse primer sequence of the RPA specific primer is
[0031] CCTCCCAGAGCCATGTTACCCGGTCTGAAGGA;
[0032] The probe sequence is:
[0033] (FAM)cactctggcgacgcgtttgtggttgaaccgccaTc(THF)gTggaggcttcaaaggc(C3spacer).
Embodiment 2
[0034] The agarose gel analysis of embodiment 2 reaction product
[0035]First extract CyHV-II virus according to the following steps: (1) add and add sample PBS buffer and mix evenly, centrifuge at 8000rpm for 5min, discard the supernatant; (2) add 1ml buffer and 20μL protease and incubate in a 56°C water bath for 3h; (3) Centrifuge at 8000rpm for 5min, take 750μL supernatant and put it in a new centrifuge tube, add phenol: chloroform: isoamyl alcohol with a volume ratio of 25:24:1, mix at 50rpm for 10min, then centrifuge at 8000rpm for 5min, Take 650 μL of supernatant in a new centrifuge tube, repeat the above operation and ensure that the protein layer is not sucked; (4) Take 600 μL of supernatant in a new centrifuge tube, add chloroform:isoamyl alcohol at a volume ratio of 24:1 Mix at a speed of 50 rpm for 10 minutes, then centrifuge at 8000 rpm for 5 minutes; (5) Take 480 μL of the supernatant in a new centrifuge tube, add 40 μL of 3 mol / L sodium acetate and 960 μL of 4°C...
Embodiment 3
[0037] The test strip analysis of embodiment 3 reaction products
[0038] The extraction of CyHV-II virus is the same as in Example 2, and the PCR amplification reaction is carried out according to the following composition and proportioning reaction system, wherein, 2.1 μl of upstream primers, 2.1 μl of downstream primers, 0.6 μl of fluorescent probes, 29.5 μl of RehydrationBuffer, and 2 μl of viral DNA , ddH 2 O11.2 μl, the total amount is 47.5 μl. The reaction steps of RPA test strip detection are as follows: ①Mix the above components, shake slightly and centrifuge for several seconds; ②Put the mixture into a 0.2mL Twist Amp Basic reaction tube containing lyophilized enzyme powder and aspirate several times; ③Add 2.5μL of 280mM Repeated absorption of magnesium acetate several times; ④ Put it in a metal incubator at 38°C for 4 minutes, take it out and mix well, and then put it in a metal incubator at 38°C for 36 minutes; figure 2 shown. When there are two bands on the te...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com