The application of gene and the construction method of animal model
An animal model and gene technology, applied in the field of gene application and animal model construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Construction of embodiment 1 overexpression vector
[0056] 1. The β-actin promoter was amplified by PCR
[0057] Using the plasmid as a template, the β-actin promoter was amplified by PCR, as follows:
[0058] (1) PCR primer sequence:
[0059]
[0060] (2) Reaction system
[0061]
[0062] (3) PCR amplification conditions:
[0063] 98℃2min
[0064]
[0065] Store at 4°C
[0066] 2. Perform gel recovery on the amplified PCR product.
[0067] 3. Digest the vector frame pVector and the β-actin promoter amplified in step 2 with restriction endonucleases HindII and ApoI, and recover 3kb and 1.7kb fragments from the gel.
[0068] 4. Connection
[0069] Reaction system (25μl): (Reagents from TAKARA)
[0070] T4 DNA Ligation buffer 2.5μl β-actin fragment 1μl (75ng) pVector 1μl (50ng) T4 DNA Ligase 0.5μl wxya 2 o
20μl
[0071] Ligate overnight at 16°C.
[0072] 5. Cloning construction (transformation, extraction...
Embodiment 2
[0100] Example 2 transgene
[0101] 1. Collection of fertilized eggs
[0102] (1) Select F1 (DBA / 2 female × C57BL / 6 male) female mice that are sexually mature at 4 weeks, inject 5 IU of pregnant horse serum gonadotropin (PMSG) intraperitoneally, and then inject 5 IU human Chorionic gonadotropin (hCG) in the same mouse, superovulate female mice. The hCG-injected female mice were quickly caged with C57BL / 6J mice.
[0103] (2) Check the thrombus on the second day, kill the female mouse that sees the thrombus, open the abdominal cavity of the mouse, fully expose the abdominal cavity and uterine horn, and carefully cut off the oviduct and part of the uterine horn under a dissecting microscope to place M2 and hyaluronic acid Acid mixture in a 35mm dish. When the enlarged ampullary area is torn open with ophthalmic forceps, free fertilized eggs can be seen gushing out. Under the action of hyaluronidase, some clustered cell clusters will disperse into single cells.
[0104] (3) Tr...
Embodiment 3
[0114] Embodiment 3 mouse genotype identification
[0115] 1. Use sterilized scissors to cut and number the toes of the mice within two weeks of birth, and put the cut toes into 1.5ml EP tubes with corresponding numbers.
[0116] 2. Add 100 μl mouse tail digestion solution (1ml GNTK+5μl 20mg / ml Proteinase K) to the EP tube. Centrifuge, 12000rpm, 5min. It was then placed in a 55°C water bath for overnight digestion.
[0117] 3. Boil the digested rat tail for 15 minutes to inactivate Proteinase K. Centrifuge, 12000rpm, 2min. The supernatant after centrifugation is the PCR template.
[0118] 4. Prepare the PCR reaction system and select the corresponding program for the reaction. Afterwards, gel was run for band analysis.
[0119] 1. PCR primer sequence:
[0120] OXTR:AATGCCCTGGCTCACAAATAC (Forward), as shown in SEQ ID No.5 GGGACAGCTATGACTGGGAGTAG (Reverse), as shown in SEQ ID No.6 The resulting fragment size was 456bp.
[0121] 2. Reaction system ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com