Rice double-flower spikelet gene DF1, protein coded by rice double-flower spikelet gene DF1 and application
A protein and gene technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as unavailability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] 1. Rice material
[0052] Rice (Oryza sativa L.) mutant df1 (doublefloret 1), the original wild-type material is the indica variety Wenxiang 28. The df1 mutant is a natural mutant from Wenxiang 28 ( figure 1 ).
[0053] 2. Analyze and target groups:
[0054] The reciprocal cross experiment between the df1 mutant and Wenxiang 28 showed that the mutant was controlled by a single recessive gene. When the homozygous df1 mutant was crossed with the japonica variety W7, F 1 Generation selfing, and from F 2 From the population, 1268 individuals with double-flowered spikelet phenotype were selected as the mapping population. Take about 1 gram of leaves from each plant at the heading stage to extract total DNA.
[0055] 3. DNA extraction
[0056] Genomic DNA for gene localization was extracted from rice leaves by a rapid extraction method of rice trace DNA. About 0.3g of rice leaves were taken, quick-frozen in liquid nitrogen, ground into powder in a small mortar with a...
Embodiment 2
[0067] Plant Transformation:
[0068] Using homologous recombination and PCR techniques, the HindIII and EcoRI restriction sites were introduced into the amplification primers respectively. The amplification primers were: DF1com-1F: ATGTCAACGGCGTTATGACTGAC, DF1com-1R: GAACCGACTTTGGACGGTCAAG, and the annealing temperature was 60°C. The front primer contains a HindIII restriction site, and the back primer contains an EcoRI restriction site. Use this primer to PCR amplify the DNA of Wenxiang 28, recover and purify the 6022-bp fragment after electrophoresis, and also digest the pCAMBIA1301 vector with HindIII and EcoRI, and then connect the recovered and purified fragment with the correct size to the digested vector Escherichia coli transformation was carried out, and positive single clones were selected for sequencing. Obtain the correct transformation vector pCA1301-DF1 ( Figure 6 shown), the rice df1 mutant was transformed into the Agrobacterium tumefaciens strain LBA4404 by...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap