Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice double-flower spikelet gene DF1, protein coded by rice double-flower spikelet gene DF1 and application

A protein and gene technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as unavailability

Inactive Publication Date: 2018-01-19
CHINA NAT RICE RES INST
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, rice mfs1, snb, and tob1 mutant spikelets also exhibit many other floral organ defects in addition to multi-flowered traits, and cannot be directly utilized in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice double-flower spikelet gene DF1, protein coded by rice double-flower spikelet gene DF1 and application
  • Rice double-flower spikelet gene DF1, protein coded by rice double-flower spikelet gene DF1 and application
  • Rice double-flower spikelet gene DF1, protein coded by rice double-flower spikelet gene DF1 and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] 1. Rice material

[0052] Rice (Oryza sativa L.) mutant df1 (doublefloret 1), the original wild-type material is the indica variety Wenxiang 28. The df1 mutant is a natural mutant from Wenxiang 28 ( figure 1 ).

[0053] 2. Analyze and target groups:

[0054] The reciprocal cross experiment between the df1 mutant and Wenxiang 28 showed that the mutant was controlled by a single recessive gene. When the homozygous df1 mutant was crossed with the japonica variety W7, F 1 Generation selfing, and from F 2 From the population, 1268 individuals with double-flowered spikelet phenotype were selected as the mapping population. Take about 1 gram of leaves from each plant at the heading stage to extract total DNA.

[0055] 3. DNA extraction

[0056] Genomic DNA for gene localization was extracted from rice leaves by a rapid extraction method of rice trace DNA. About 0.3g of rice leaves were taken, quick-frozen in liquid nitrogen, ground into powder in a small mortar with a...

Embodiment 2

[0067] Plant Transformation:

[0068] Using homologous recombination and PCR techniques, the HindIII and EcoRI restriction sites were introduced into the amplification primers respectively. The amplification primers were: DF1com-1F: ATGTCAACGGCGTTATGACTGAC, DF1com-1R: GAACCGACTTTGGACGGTCAAG, and the annealing temperature was 60°C. The front primer contains a HindIII restriction site, and the back primer contains an EcoRI restriction site. Use this primer to PCR amplify the DNA of Wenxiang 28, recover and purify the 6022-bp fragment after electrophoresis, and also digest the pCAMBIA1301 vector with HindIII and EcoRI, and then connect the recovered and purified fragment with the correct size to the digested vector Escherichia coli transformation was carried out, and positive single clones were selected for sequencing. Obtain the correct transformation vector pCA1301-DF1 ( Figure 6 shown), the rice df1 mutant was transformed into the Agrobacterium tumefaciens strain LBA4404 by...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice double-flower spikelet gene DF1. The rice double-flower spikelet gene DF1 has a genome nucleotide sequence shown as Seq ID NO: 1 and a cDNA (complementary Deoxyribonucleic Acid) nucleotide sequence shown as Seq ID NO: 2; the invention further discloses protein coded by the protein and has an amino acid sequence shown as Seq ID NO: 3; the invention further discloses amutant gene of the gene and protein coded by the mutant gene, a recombinant expression vector and a host cell which contain the gene, and a method for regulating and controlling the quantity of spikelets and flowerlets of gramineous plants by utilizing the gene; the invention further discloses application of the gene and the protein and the like to regulation and control of the quantity and the yield of the spikelets and the flowerlets of the gramineous plants. According to the rice double-flower spikelet gene DF1, one DF1 gene which influences deterministic development of the spikelets of rice is separated by utilizing a map-based cloning technology and functions of the gene are identified by utilizing a transgene complementary test; the spikelet number of the rice can be improved through a molecular design of the quantity of the flowerlets in the spikelets and novel concept and method are provided for culturing high-yield new varieties.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice double flower spikelet gene DF1 (DOUBLEFLORET 1) and its encoded protein and application. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in the world and a model plant of monocots. Compared with dicotyledonous model plants, rice inflorescence has a unique structural unit of Poaceae - spikelet. In-depth research on the reproductive and development process of rice will not only help to understand the formation mechanism of rice spikelets and the molecular evolution of grasses, but also It is of great significance to improve the yield and quality of rice. [0003] In grasses, spikelets consist of many bract-like organs and a variable number of florets. Spikelets or florets are an important yield factor for gramineous plants such as rice, corn, wheat, etc. Research on the regulation mechanism of spikelet development will he...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/20C12N15/55C12N15/82C12N5/10A01H5/00A01H6/46
Inventor 任德勇钱前余海平徐乾坤周亭亭崔元江郭龙彪曾大力张光恒胡江朱丽
Owner CHINA NAT RICE RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com