Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Standard gene for disk bacteria identification and application of standard gene

A standard gene and disc technology, applied in the field of molecular identification of species, can solve the problems of insufficient research on molecular phylogeny, obstacles in classification, scientific naming and diversity research, lack of molecular evidence and species definition standards, etc., to improve identification efficiency, Effects with low integrity requirements

Active Publication Date: 2017-09-19
YUNNAN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because this family of fungi contains many anamorphic genera and species, and the morphological characteristics of species are diverse, there is no obvious microstructural difference between some species, and the molecular phylogeny of this type of fungi is currently insufficient, and molecular evidence and species definition standards are lacking. , causing great obstacles to its taxonomy, scientific nomenclature and diversity studies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Standard gene for disk bacteria identification and application of standard gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Homology Identification of Test Samples and Discobacterium discus DNA Barcode Identification Standard Gene Fragments

[0018] 1. Collection and preservation of disc fungus specimens: 10 samples were collected from Yunnan Province.

[0019] 2. Extract Genomic DNA of Disc bacterium: Genomic DNA was extracted by the improved CTAB method, and the DNA concentration of the sample was diluted to 0.5 μg / μl with sterilized deionized water.

[0020] 3. Amplify the DNA fragment and carry out polymerase chain reaction (PCR), that is, amplify with universal primers, and the sequence of the outer primer pair is:

[0021] Forward primer ML7: 5'GACCCTATGCAGCTTCTACTG3';

[0022] Reverse primer ML8: 5'TTATCCCTAGCGTAACTTTTATC3';

[0023] 4. According to the specific primer according to claim 2, it is characterized in that the inner primer sequence is:

[0024] Forward primer ML-chaoF: 5'AGAACAACGGCTAGGTGG3';

[0025] Reverse primer ML-chaoR: 5'GAACGAGTCCGCAGAAGA 3'.

[002...

Embodiment 2

[0029] Embodiment 2: Using the phylogenetic tree method to set up identification rules to identify species

[0030] 1. Use the steps described in Example 1 to obtain the sequence of the sample to be tested, combine the standard gene sequence and the sample sequence to be identified with the mtLSU sequence of the sample to be tested, and use MEGA to repeat 1000 times to construct a phylogeny based on the Kimura-2-parameter model tree, the DNA barcode sequences of unidentified samples were clustered together with the standard gene sequences, and the sequences of the 6 genera of Discobacteriaceae showed obvious divergence, sequence 1 and Arthrobotrymusiformis Together, it shows that the samples to be identified can be identified as Discobacterium discus.

[0031] Compared with the traditional morphological identification method, the gene sequence obtained and the method used in the present invention are beneficial to realize the rapid and accurate identification of the disc bact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a standard gene sequence for disk bacteria and an identification method, and belongs to the field of species molecule identification. The gene sequence of a standard detection mitochondrion mtLSU gene is as shown in SEQ ID NO.1. PCR (polymerase chain reaction) amplification is performed by the aid of a universal primer ML7 and a universal primer ML8 of a mitochondrion large-subunit mtLSU gene, amplification is performed by the aid of a specific primer sequence ML-chaoF: AGAACAACGGCTAGGTGG and a specific primer sequence ML-chaoR: GAACGAGTCCGCAGAAGA, and PCR products are sequenced after being verified by the aid of agarose gel. Disk bacteria can be rapidly and accurately identified according to sequence differences of the mtLSU gene. A lot of time for identifying morphology of the bacteria cannot be consumed by the aid of reliable DNA (deoxyribonucleic acid) molecule identification technique, so that the disk bacteria can be rapidly and accurately identified, and a powerful research tool is provided for prevention of animal and plant threadworms.

Description

technical field [0001] The invention relates to the field of molecular identification of species, in particular to a standard gene for molecular identification of disc fungus and its application. Background technique [0002] Discobacteriaceae ( Orbiliaceae ) is a small plate fungus that is widely distributed worldwide and lives saprophytically. In the long history of evolution, in order to adapt to the living environment, its mycelium can metamorphose into various exquisitely structured predatory organs to prey on nematodes, and it can also metamorphose and re-parasitize other plant pathogenic fungi. In addition, some virulence factors can also be produced, such as extracellular enzymes including serine protease, chitinase and collagenase, etc., which directly or indirectly participate in the process of infecting the nematode body wall. This kind of fungus is an important factor in the natural control of nematode populations, and it is also an important research materia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6895C12Q2600/166
Inventor 张颖张克勤张云润董建勇蒋力力
Owner YUNNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com