Standard gene for disk bacteria identification and application of standard gene
A standard gene and disc technology, applied in the field of molecular identification of species, can solve the problems of insufficient research on molecular phylogeny, obstacles in classification, scientific naming and diversity research, lack of molecular evidence and species definition standards, etc., to improve identification efficiency, Effects with low integrity requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: Homology Identification of Test Samples and Discobacterium discus DNA Barcode Identification Standard Gene Fragments
[0018] 1. Collection and preservation of disc fungus specimens: 10 samples were collected from Yunnan Province.
[0019] 2. Extract Genomic DNA of Disc bacterium: Genomic DNA was extracted by the improved CTAB method, and the DNA concentration of the sample was diluted to 0.5 μg / μl with sterilized deionized water.
[0020] 3. Amplify the DNA fragment and carry out polymerase chain reaction (PCR), that is, amplify with universal primers, and the sequence of the outer primer pair is:
[0021] Forward primer ML7: 5'GACCCTATGCAGCTTCTACTG3';
[0022] Reverse primer ML8: 5'TTATCCCTAGCGTAACTTTTATC3';
[0023] 4. According to the specific primer according to claim 2, it is characterized in that the inner primer sequence is:
[0024] Forward primer ML-chaoF: 5'AGAACAACGGCTAGGTGG3';
[0025] Reverse primer ML-chaoR: 5'GAACGAGTCCGCAGAAGA 3'.
[002...
Embodiment 2
[0029] Embodiment 2: Using the phylogenetic tree method to set up identification rules to identify species
[0030] 1. Use the steps described in Example 1 to obtain the sequence of the sample to be tested, combine the standard gene sequence and the sample sequence to be identified with the mtLSU sequence of the sample to be tested, and use MEGA to repeat 1000 times to construct a phylogeny based on the Kimura-2-parameter model tree, the DNA barcode sequences of unidentified samples were clustered together with the standard gene sequences, and the sequences of the 6 genera of Discobacteriaceae showed obvious divergence, sequence 1 and Arthrobotrymusiformis Together, it shows that the samples to be identified can be identified as Discobacterium discus.
[0031] Compared with the traditional morphological identification method, the gene sequence obtained and the method used in the present invention are beneficial to realize the rapid and accurate identification of the disc bact...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap