Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immunodeciency mouse model, preparation method and application thereof

A technology of immunodeficiency mice and mouse models, which is applied in the field of animal genetic engineering, can solve problems such as interference of hair test results, and achieve the effect of improving efficiency

Inactive Publication Date: 2017-09-01
湖南昭泰生物医药有限公司
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In addition, all current highly immunodeficiency mice (deficient of B, T, NK and other immune cells), including NOD-Scid IL2rg- / -, Rag2- / -IL2rg- / -, Rag1- / -IL2rg- / -, etc., It is extremely efficient in constructing tumor models, but these mice have hair, and when using techniques such as in vivo imaging to detect the growth and distribution of tumor cells with fluorescent markers (especially fluorescent proteins), the hair is of great importance to the detection results. have serious interference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunodeciency mouse model, preparation method and application thereof
  • Immunodeciency mouse model, preparation method and application thereof
  • Immunodeciency mouse model, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Embodiment 1: Construction of Cas9 knockout system plasmid

[0084] (1) Target selection: use the ZiFiT Targeter Version website to design the sequence of GGN(17-18)NGG (N is any base) that follows the Cas9 knockout target. The site's "Blast" search function identifies the target site as a single site in the genome;

[0085] Target site sequence: ggaagtgcctcttgtagggg (SEQ ID NO.1)

[0086] Target confirmation: Design high-specificity primers for amplifying the target site according to the genome of the target cell, and obtain a fragment containing the target site through PCR amplification; select the only restriction endonuclease for the amplified fragment in the target site for digestion Electrophoresis identification; after the enzyme digestion identification is correct, send the PCR amplification product to sequencing identification; through enzyme digestion and sequencing identification, confirm the specificity of the targeting identification primers and the feasib...

Embodiment 2

[0108] Example 2: Construction and validation of NSIN mice

[0109] (1) Superovulation of NSI mice: age of male mice: 10-11 weeks, age of female mice: 8 weeks. Female mice were injected with PMSG (7.5IU / mouse) at 13:00 on the first day, HCG (7.5IU / mouse) at 13:00 on the third day, and each female mouse was caged with 2 male mice at 17:00 on the third day. On the fourth day, 8:00-9:00 check the vaginal suppository of female mice, and obtain fertilized eggs of NSI mice from the uterus of female mice with suppository;

[0110] Precautions for the production of NSI male and female mice that provide sperm: NSI female mice and parent mice (the mother and father of NSI male and female mice that provide sperm) are housed together, and the parent mice are separated. out, put into the ICR dams with at least one production experience to ensure that the offspring of NSI dams are sufficient for breastfeeding;

[0111] (2) Inject the pronucleus of gRNA and Cas9mRNA at a concentration of 2...

Embodiment 3

[0117] Embodiment 3: Construction of TALEN plasmid

[0118] (1) Use TELAN Targeter software to analyze the Fah gene CDS sequence (NOD-scid IL2rg- / - mouse background), and select the most specific gene locus from the Fah gene CDS sequence as the TALEN target;

[0119] TALEN target sequence: 5-aagctgcatggaagg-3;

[0120] TALEN left arm recognition binding sequence: 5-aacttcatgggtctgggtc-3;

[0121] TALEN right arm recognition binding sequence: 5-aaggatgctcttgcct-3;

[0122] (2) Design the sequences of the left and right arms of the TALEN according to the sequence recognized and combined by the left and right arms of the TALEN targeting the Fah gene, and the principle of TALE recognition and coding, such as Figure 11 Shown:

[0123] TALEN left arm: AACTTCATGGGTCTGGGTCAAG;

[0124] TALEN right arm: AAGGATGCTCTTGCCTCCT;

[0125] (3) Gene synthesis of TALEN left arm and right arm repeat sequences containing BsmBI (ie, Esp3I, Thermo Scientific Company, model FD0454) restriction...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of animal genetic engineering, the invention in particular relates to an immunodeciency mouse model, a preparation method and application thereof. The preparation method employs NOD-Scid IL2rg- / -immunodeficiency mouse (NSI mouse) to knock out Foxnl gene or Fah gene. According to the invention, an NSIF mouse is obtained by knockout of Fah gene from an NSI mouse, the NSI mouse can be used for efficient construction of a novel humanized mouse model, and can be used for physiological and pathological study of liver. In the invention, the NSIF mouse is obtained by knockout of Foxn1 gene from the NSI mouse, has no body hair, and the immune system has further defect, and the immunodeciency mouse model is easy for construction, monitoring and measurement of solid tumors.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering, and in particular relates to an immunodeficiency mouse model, its preparation method and application. Background technique [0002] The liver occupies a strategic position in the body's ability to detoxify and metabolize xenobiotic compounds. Due to the advantages of low cost of feeding mice, fast reproduction speed, short experimental period, clear genetic background, and high experimental repeatability, researchers use mice to construct various mouse liver disease models, such as liver injury, viral hepatitis, liver fibrosis, etc. Hepatic cancer, liver cancer, etc., to conduct research on liver diseases. However, these models are difficult to make up for the huge species differences between humans and mice (for example, many liver metabolic enzymes are species-specific, and some human liver viruses such as HBV, HCV, etc. cannot infect mouse liver cells). The research obtaine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89A01K67/027
CPCC12N15/89A01K2227/105C12N15/907A01K67/0275A01K2217/075A01K2267/0331A01K67/027
Inventor 不公告发明人
Owner 湖南昭泰生物医药有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products