CPS1 reporter gene human liver cell line, construction method hereof and applications thereof
A reporter gene and construction method technology, applied in the field of bioengineering, can solve the problems of hepatic cells with low function, complexity, and lack of intermediate state cells, and achieve the effect of high purity and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1, design the single-stranded guide RNA (sgRNA) of carbamoyl phosphate synthetase 1 (CPS1) gene and backbone vector construction
[0060] 1) Design the single-stranded guide RNA (sgRNA) of the carbamoyl phosphate synthase 1 (CPS1) gene by using the sgRNA target design software on the website of MIT Zhang Feng Laboratory (URL: crispr.mit.edu) to identify the CPS1 gene (GenBank number: 1737 ), the target sequence of the CPS1 gene is: AGCTGTGCAGAAATCTCGCA (located at 4759-4778 bases from the 5' end of the CPS1 gene), and a cohesive end that can be digested with Bbs I is added to this sequence The nucleotides that form a pair, the specific sequence is as follows:
[0061] oligo1:5'- CACC AGCTGTGCAGAAATCTCGCA-3',
[0062] oligo2:5'- TTTG ACGCTCTAAAGACGTGTCGA-3';
[0063] The underlined sequence can be complementary to the end of Bbs I digestion. Oligo1 and Oligo 2 contain guide sequence sgRNA, which can form sgRNA with the backbone sequence contained in the t...
Embodiment 2
[0079] Example 2. Construction of the targeting vector pET32-CPSLR-tdTomato of the CPS1 gene
[0080] Such as figure 2 As shown, the construction process of the targeting vector pET32-CPSLR-tdTomato of the CPS1 gene includes the following steps:
[0081] 1) Design primers for amplification of the CPS1 gene left arm insert (CPSL) and right arm insert (CPSR). The primer sequences are as follows (please provide the following primer sequences):
[0082] CPS1 Gene Left Arm Insert Segment (CPSL) Amplification Primers:
[0083] Forward primer (CPSL-F): 5'-GAAGATCTTTGTGTGAATCTTCAGGAATA-3'
[0084] Reverse primer (CPSL-R): 5'-CGGATATCTGCTGCTTTTCCAGCACTGT-3';
[0085] CPS1 Gene Right Arm Insert Segment (CPSR) Amplification Primers:
[0086] Forward primer (CPSR-F): 5'-ACGCGTCGACAGATGCAGACACCCCAGCC-3'
[0087] Reverse primer (CPSR-R): 5'-CCCAAGCTTGAAGTAATGAAAGTCTTGAC-3'.
[0088] 2) PCR amplification of CPS1 gene left arm insert (CPSL) and right arm insert (CPSR) PCR reaction syst...
Embodiment 3
[0120] Example 3, construction of CPS1-tdtomato reporter human liver cancer cell line (HepG2) and liver cell line (LO2)
[0121] Mix pX458-sgCPS1 (backbone carrier of CPS1 gene) plasmid and pET32-CPSLR-tdTomato (targeting carrier of CPS1 gene) plasmid in a ratio of 1:3 (mass ratio), and mix each 10 6 Human liver cell line cells (HepG2 or LO2) were mixed with 2 μg of mixed plasmids, 1050V 30pulse electric shock twice, and the cells were resuspended in 2mL high-glucose DMEM medium containing 10% (V / V) fetal bovine serum for 24 hours Then add 200 μg / mL G418 (Geneticin, Geneticin) to screen, after 15 days, obtain G418 resistant clone, extract its genomic DNA, use the oligonucleotide (sequence: 5 '-GAAGATCTTTGTGTGAATCTTCAGGAATA-3' and 5'-CCATGTTGTTGTCCTCGGAGGA-3') were amplified by PCR and the PCR amplification products were sequenced to obtain reporter cells of CPS1-tdtomato human liver cell line. CPS1-tdtomato reported HepG2, LO2 cells were labeled as HepG2-CPS-tdTomato (HCT) an...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com