Immunodeficient mice, manufacturing method thereof and application
An immunodeficient mouse and mouse technology, applied in the field of immunodeficient mice, can solve problems such as interference of hair test results, and achieve the effect of improving efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0091] Embodiment 1: Construction of Cas9 knockout system plasmid
[0092] (1) Target selection: use the ZiFiT Targeter Version website to design the sequence of GGN(17-18)NGG (N is any base) that follows the Cas9 knockout target. The site's "Blast" search function identifies the target site as a single site in the genome;
[0093] Target site sequence: ggaagtgcctcttgtagggg (SEQ ID NO.1)
[0094] Target confirmation: Design high-specificity primers for amplifying the target site according to the genome of the target cell, and obtain a fragment containing the target site through PCR amplification; select the only restriction endonuclease for the amplified fragment in the target site for digestion Electrophoresis identification; after the enzyme digestion identification is correct, send the PCR amplification product to sequencing identification; through enzyme digestion and sequencing identification, confirm the specificity of the targeting identification primers and the feasib...
Embodiment 2
[0116] Example 2: Construction and validation of NSIN mice
[0117] (1) Superovulation of NSI mice: age of male mice: 10-11 weeks, age of female mice: 8 weeks. Female mice were injected with PMSG (7.5IU / mouse) at 13:00 on the first day, HCG (7.5IU / mouse) at 13:00 on the third day, and each female mouse was caged with 2 male mice at 17:00 on the third day. On the fourth day, 8:00-9:00 check the vaginal suppository of female mice, and obtain fertilized eggs of NSI mice from the uterus of female mice with suppository;
[0118] Precautions for the production of NSI male and female mice that provide sperm: NSI female mice and parent mice (the mother and father of NSI male and female mice that provide sperm) are housed together, and the parent mice are separated. out, put into the ICR dams with at least one production experience to ensure that the offspring of NSI dams are sufficient for breastfeeding;
[0119] (2) Inject the pronucleus of gRNA and Cas9 mRNA at a concentration of ...
Embodiment 3
[0125] Embodiment 3: Construction of TALEN plasmid
[0126] (1) Use TELAN Targeter software to analyze the Fah gene CDS sequence (NOD-scid IL2rg- / - mouse background), and select the most specific gene locus from the Fah gene CDS sequence as the TALEN target;
[0127] TALEN target sequence: 5-aagctgcatggaagg-3;
[0128] TALEN left arm recognition binding sequence: 5-aacttcatgggtctgggtc-3;
[0129] TALEN right arm recognition binding sequence: 5-aaggatgctcttgcct-3;
[0130] (2) Design the sequences of the left and right arms of the TALEN according to the sequence recognized and combined by the left and right arms of the TALEN targeting the Fah gene, and the principle of TALE recognition and coding, such as Figure 11 Shown:
[0131] TALEN left arm: AACTTCATGGGTCTGGGTCAAG;
[0132] TALEN right arm: AAGGATGCTCTTGCCTCCT;
[0133] (3) Gene synthesis of TALEN left arm and right arm repeat sequences containing BsmBI (ie, Esp3I, Thermo Scientific Company, model FD0454) restriction...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com