Recombinant plasmid pMDMcherry, construction method of recombinant plasmid and method for marking Edwardsiella ictaluri with red fluorescent protein gene
A red fluorescent protein, recombinant plasmid technology, applied in microorganism-based methods, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effects of reducing costs, high stability, and simple and intuitive methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The construction method of embodiment 1 recombinant plasmid PMDMcherry
[0030] The construction method of the recombinant plasmid PMDMcherry of the present embodiment comprises the following steps:
[0031] (1) Preparation of promoter fragments:
[0032] Using the plasmid PRUAL as a template, ppS (SEQ ID No: 1) and ppA (SEQ ID No: 2) as upstream and downstream primers, the PCR reaction was carried out according to conventional methods, and the PCR products were subjected to 1% agarose electrophoresis with Gel Extraction Kit (day Root Biochemical Technology (Beijing) Co., Ltd.) for gel recovery to obtain the promoter fragment, the sequence number is SEQ ID No:3. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2:
[0033] ppS: 5'CGCCTAGGATACGCACACCGTGGAAAC3' (SEQ ID No: 1)
[0034] ppA: 5'CCTTGCTCACCATTTTTTCTTCCTCCA3' (SEQ ID No: 2)
[0035] Table 1 PCR amplification system
[0036]
[0037]
[0038] Table 2 PCR ...
Embodiment 2
[0050] Embodiment 2 The preparation method of red fluorescent protein gene marker Edwardsiella
[0051] The preparation method of the red fluorescent protein gene marker Edwardsiella of the present embodiment comprises the following steps:
[0052] (1) Using conventional operating methods, isolate the highly virulent strain of Edwardsiella spp. from the diseased zebrafish;
[0053] (2) Prepare the competent state of Edwardsiella spp.
[0054] Methods as below:
[0055] (a) Inoculate Edwardsiella sibriculi into BHI liquid medium, cultivate overnight at 28° C. on a shaker at 280 rpm;
[0056] (b) transfer to 500ml BHI liquid culture medium according to the amount of 1:500, 280rpm, 2.5-3.5h, cultivate until OD600 is 0.6;
[0057] (c) Immediately quench in an ice-water bath: You can choose to place a large container with ice-water mixture on a shaker and quickly rotate and shake to cool down the temperature of the culture as soon as possible;
[0058] (d) Centrifuge in a 250ml...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com