Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-PD-1 (programmed cell death 1) monoclonal antibody as well as pharmaceutical composition and application thereof

A monoclonal antibody, PD-1 technology, applied in the field of tumor therapy and molecular immunology, can solve problems such as liver damage

Inactive Publication Date: 2017-05-10
ZEDA BIOPHARMACEUTICALS INC
View PDF6 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PD-1 plays a very important role in the process of negatively regulating the activation of T cells. The negative regulation of T cells mediated by PD-1 can reduce the tissue damage caused by the pro-infection process, but blocking or inhibiting the activation of PD-1 Negative regulation can lead to autoimmune diseases, for example, PD-1 knockout mice can more effectively clear pancreatic virus infection, but lead to more severe liver damage (Isai et al., 2003, J. Exp. Med.198:39-50)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-PD-1 (programmed cell death 1) monoclonal antibody as well as pharmaceutical composition and application thereof
  • Anti-PD-1 (programmed cell death 1) monoclonal antibody as well as pharmaceutical composition and application thereof
  • Anti-PD-1 (programmed cell death 1) monoclonal antibody as well as pharmaceutical composition and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0124] Preparation Example 1: Synthesis of Antigens PD-1-mFc, PD-1-hFc and PDL-1-hFc

[0125] 1. Synthesis of genes PD-1-mFc and PD-1-hFc

[0126] The amino acids corresponding to the extracellular fragment PD-1ECD of the gene PD-1 (Programmed cell death protein 1, NCBI GenBank: NM_005018) are respectively related to the Fc protein fragment (mFc) of TEV and mouse IgG and the Fc protein of TEV and human IgG Fragment (hFc) was fusion designed. In order to improve the expression efficiency of the target gene in the 293F cell expression system, GenScript was entrusted to optimize the nucleic acid sequence corresponding to the fusion protein sequence. The optimization mainly considered codon bias, GC Content, secondary structure of mRNA, repetitive sequence and other factors. Finally, the optimized sequences of PD-1 ECD-TEV-mFc and PD-1 ECD-TEV-hFc fusion protein genes were entrusted to GenScript to synthesize.

[0127] 2. Acquisition of pUC57simple-PD-1ECD-TEV-mFc plasmid

[...

Embodiment 1

[0158] Example 1: Obtaining of hybridoma cell line LT004 and preparation of monoclonal antibody 6F5

[0159] Mammalian cell expression system was used to express recombinant PD-1ECD-TEV-mFc as an antigen to immunize mice, and hybridoma cells were obtained by fusion of mouse spleen cells and myeloma cells. Through the screening of a large number of samples, a hybridoma cell line LT004 was obtained, which can secrete and produce monoclonal antibody 6F5 that specifically binds to PD-1. The specific method is as follows:

[0160] 1. Establishment of hybridoma cell line LT004

[0161] Using PD-1ECD-TEV-mFc fusion protein (i.e. PD-1-mFc, see Preparation Example 1) as an antigen, take the splenocytes and mouse myeloma cells from immunized BALB / C mice (purchased from Guangdong Medical Experimental Animal Center). The cells were fused into hybridoma cells according to the established method (e.g., Stewart, S.J., "Monoclonal Antibody Production", in Basic Methods inantibody Producti...

Embodiment 2

[0168] Example 2: Obtaining the Light Chain and Heavy Chain Sequences of Monoclonal Antibody 6F5

[0169] The mRNA was extracted from the hybridoma cell line LT004 prepared in Example 1 according to the method of Total RNA Extraction Kit from Cultured Bacteria (Tiangen, Cat. No. DP430).

[0170] cDNA was synthesized according to the instructions of the TransScript First-Strand cDNA Synthesis SuperMix (Transgen, AT301) kit, and PCR amplification was performed. The PCR amplification product was directly cloned by TA, and the specific operation was carried out according to the instructions of the pEASY-T1 Cloning Kit (Transgen CT101) kit.

[0171]The products of TA clones were directly sequenced, and the sequencing results were as follows:

[0172] DNA sequencing results of heavy chain variable region: (426bp)

[0173] GAGGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGTCTGGAGTGGGTCGCAACCATTAGTGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of oncotherapy and molecular immunology, and relates to an anti-PD-1 (programmed cell death 1) monoclonal antibody as well as pharmaceutical composition and an application thereof, in particular to a monoclonal antibody or an antigen binding fragment thereof. The heavy chain variable region of the monoclonal antibody contains CDR with amino acid sequences represented as SEQ ID NO: 13-15; and / or the light chain variable region of the monoclonal antibody contains CDR with amino acid sequences represented as SEQ ID NO: 16-18. The monoclonal antibody can be specifically bound with PD-1 very well, specifically remove immunosuppression of PD-1 on an organism and activate T lymphocytes.

Description

technical field [0001] The invention belongs to the fields of tumor therapy and molecular immunology, and relates to an anti-PD-1 antibody, its pharmaceutical composition and its application. Specifically, the present invention relates to an anti-PD-1 monoclonal antibody. Background technique [0002] The transmembrane receptor PD-1 (programmed cell death 1, programmed cell death factor 1) is a member of the CD28 gene family and is expressed in activated T cells, B cells and myeloid cells. The ligands PDL-1 and PDL-2 of PD-1 belong to the B7 superfamily, in which PDL-1 is expressed in many cells, including T cells, B cells, endothelial cells and epithelial cells, while PDL-2 is only expressed in Antigen presenting cells such as dendritic cells and macrophages. [0003] T cells play a very important role in clearing viral infections, but T cell antiviral responses are often associated with immunopathology. PD-1 plays a very important role in the process of negatively regul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13C12N5/20G01N33/68G01N33/577A61K39/395A61P35/00A61P35/02A61P7/06A61K49/00A61K51/10
CPCA61K39/395C07K16/28C12N15/63G01N33/577
Inventor 李百勇夏瑜王忠民张鹏
Owner ZEDA BIOPHARMACEUTICALS INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com