Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

New Application of Tomato s-Nitrosoglutathione Reductase Gene

A nitrosoglutathione and reductase technology, applied in the field of genetic engineering, can solve problems such as toxic effects

Active Publication Date: 2019-09-27
KUNMING UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, it is believed that the effect of NO on plants is dual. Low concentration of NO can protect plants from damage under stress, but NO itself is a highly active free radical, which can cause some toxic effects at high concentrations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New Application of Tomato s-Nitrosoglutathione Reductase Gene
  • New Application of Tomato s-Nitrosoglutathione Reductase Gene
  • New Application of Tomato s-Nitrosoglutathione Reductase Gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: SlADH3 PCR Amplification and TA Cloning of Gene cDNA

[0040] Find Tomatoes from GenBank SlADH3 cDNA sequence of the gene, and design a pair of primers with the following sequence:

[0041] The upstream primer is SlADH3-F-SalI: 5'- GTC GAC ATGGCTACACAAGGTCAAGT-3' (underlined to add Sal I restriction site); the downstream primer is SlADH3-R-KpnI: 5'- GGTACC TCATACAAACATATCCAGGAC (underlined to add Kpn I restriction site). Using tomato first-strand cDNA as a template to amplify and obtain by PCR SlADH3 The full-length cDNA of the gene (1140bp);

[0042] Use TRIzoL Reagent (Takara) to extract total RNA from tomato seedlings, take about 0.1 g of tomato tender roots, add 1 mL of TRIzoL extract, grind in a mortar, let stand at room temperature for 5 minutes, transfer to a centrifuge tube, then add 0.2 mL of chloroform, shake Mix well, centrifuge for 15 min (12000 rpm), transfer the supernatant to a new tube, add 0.5 mL of isopropanol, mix well, place...

Embodiment 2

[0044] Example 2: Construction of plant expression vector pRI101-GFP- SlADH3

[0045] use Sal I and Kpn I double enzyme cut pMD18- SlADH3 and pRI101, the cut vector and insert fragments were separated by agarose gel electrophoresis, and pMD18- SlADH3 produced after being cut SlADH3 The cDNA fragment of the gene and the vector fragment generated after cutting pRI101, and then use T4 DNA ligase of TaKaRa to connect pRI101 and SlADH3 The cDNA fragment of the gene produces the plant expression vector pRI101-GFP- SlADH3 ( figure 2 ). Conversion of high efficiencies (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Company), spread the transformed Escherichia coli on a plate added with kanamycin (Kan, 50 μg / mL), and culture overnight at 37°C , screen the Kan-resistant recombinant colony, extract the plasmid from the Kan-resistant recombinant colony, and screen the successfully connected plasmid vector pRI101- SlADH3 . ...

Embodiment 3

[0046] Example 3: Using pRI101-GFP- SlADH3 Transformation of plant expression vector into Agrobacterium

[0047] Competent cells of Agrobacterium were prepared, and the above-constructed plant expression vector pRI101-GFP- SlADH3 into Agrobacterium ( Agrobacterium tumefaciens ) LBA4404, transformants were selected on a plate supplemented with kanamycin. Take a small amount of plasmid and add it to the competent cells of Agrobacterium, mix gently; add the mixture into the pre-cooled electroporation cup, tap the cup body gently to make the mixture fall to the bottom of the cup; place the electroporation cup on the electroporation In the BIO-RAD chute, use a 1 mm electric shock cup and 200 ohm, 2.5kV / 0.2cm parameters for electric shock, take out the electric conversion cup immediately after the electric shock, quickly add 0.5mL LB medium, mix well, and transfer Put it into a 1.5 mL centrifuge tube; incubate on a shaker at 28°C for 3-5 hours at 200 rpm; centrifuge at 7500 rp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses novel application of S-nitrosoglutathione reductase genes of tomatoes. The S-nitrosoglutathione reductase genes can be used for preparing transgenic plants with enhanced nitrate resistance, NaCl resistance and drought stress resistance. The novel application has the advantages that plant expression vectors pRI101-GFP-SIADH3 are constructed by the aid of coding region sequences of the genes SIADH3 and are transferred into tobaccos by the aid of agrobacterium-mediated methods to be excessively expressed, and accordingly the nitrate resistance, the NaCl resistance and the drought stress resistance of the transgenic tobaccos can be obviously improved.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to the new application of tomato S-nitrosoglutathione reductase gene, that is, the construction of its plant expression vector and its ability to improve resistance to nitrate, NaCl and drought stress. Application of transgenic plants. Background technique [0002] Plants in nature often encounter various adverse environmental conditions, such as NO 3 - Excessive soil secondary salinization, drought, salinity, flood, low temperature, high temperature and other abiotic stresses will affect the growth and development of plants, and even cause plant death. Abiotic stress is a key factor that restricts plant growth and development, and affects crop yield and quality. Discussing the impact of abiotic stress on plant growth and development is one of the important contents in the study of plant stress resistance mechanisms. It is of great importance for the development of stres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/82A01H5/00A01H6/82
Inventor 徐慧妮郑攀郭兆来白学贵
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com