New Application of Tomato s-Nitrosoglutathione Reductase Gene
A nitrosoglutathione and reductase technology, applied in the field of genetic engineering, can solve problems such as toxic effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: SlADH3 PCR Amplification and TA Cloning of Gene cDNA
[0040] Find Tomatoes from GenBank SlADH3 cDNA sequence of the gene, and design a pair of primers with the following sequence:
[0041] The upstream primer is SlADH3-F-SalI: 5'- GTC GAC ATGGCTACACAAGGTCAAGT-3' (underlined to add Sal I restriction site); the downstream primer is SlADH3-R-KpnI: 5'- GGTACC TCATACAAACATATCCAGGAC (underlined to add Kpn I restriction site). Using tomato first-strand cDNA as a template to amplify and obtain by PCR SlADH3 The full-length cDNA of the gene (1140bp);
[0042] Use TRIzoL Reagent (Takara) to extract total RNA from tomato seedlings, take about 0.1 g of tomato tender roots, add 1 mL of TRIzoL extract, grind in a mortar, let stand at room temperature for 5 minutes, transfer to a centrifuge tube, then add 0.2 mL of chloroform, shake Mix well, centrifuge for 15 min (12000 rpm), transfer the supernatant to a new tube, add 0.5 mL of isopropanol, mix well, place...
Embodiment 2
[0044] Example 2: Construction of plant expression vector pRI101-GFP- SlADH3
[0045] use Sal I and Kpn I double enzyme cut pMD18- SlADH3 and pRI101, the cut vector and insert fragments were separated by agarose gel electrophoresis, and pMD18- SlADH3 produced after being cut SlADH3 The cDNA fragment of the gene and the vector fragment generated after cutting pRI101, and then use T4 DNA ligase of TaKaRa to connect pRI101 and SlADH3 The cDNA fragment of the gene produces the plant expression vector pRI101-GFP- SlADH3 ( figure 2 ). Conversion of high efficiencies (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Company), spread the transformed Escherichia coli on a plate added with kanamycin (Kan, 50 μg / mL), and culture overnight at 37°C , screen the Kan-resistant recombinant colony, extract the plasmid from the Kan-resistant recombinant colony, and screen the successfully connected plasmid vector pRI101- SlADH3 . ...
Embodiment 3
[0046] Example 3: Using pRI101-GFP- SlADH3 Transformation of plant expression vector into Agrobacterium
[0047] Competent cells of Agrobacterium were prepared, and the above-constructed plant expression vector pRI101-GFP- SlADH3 into Agrobacterium ( Agrobacterium tumefaciens ) LBA4404, transformants were selected on a plate supplemented with kanamycin. Take a small amount of plasmid and add it to the competent cells of Agrobacterium, mix gently; add the mixture into the pre-cooled electroporation cup, tap the cup body gently to make the mixture fall to the bottom of the cup; place the electroporation cup on the electroporation In the BIO-RAD chute, use a 1 mm electric shock cup and 200 ohm, 2.5kV / 0.2cm parameters for electric shock, take out the electric conversion cup immediately after the electric shock, quickly add 0.5mL LB medium, mix well, and transfer Put it into a 1.5 mL centrifuge tube; incubate on a shaker at 28°C for 3-5 hours at 200 rpm; centrifuge at 7500 rp...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap