Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants and construction of engineering bacteria thereof

A technology of p-hydroxyphenylglycine and hydrolase, which is applied in the field of genetic engineering, can solve the problems of poor stability, increased enzyme activity stability, low enzyme activity of immobilized cells, etc., and achieve the effect of improving oxidation resistance and high temperature resistance

Active Publication Date: 2016-10-12
CHONGQING HONOROAD ANIMAL HEALTH
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, it has been found in industrial production that the technology of separating and extracting N-carbamoyl-D-p-hydroxyphenylglycine hydrolase from microbial cells to make immobilized enzymes has been used, but the cost of enzymes is too high, and the product yield is also low. Low, and due to the low enzyme activity of cells, using conventional cell immobilization technology can increase the stability of enzyme activity, but the enzyme activity of immobilized cells is lower and it is difficult to use
Therefore, in the process of producing D-hydroxyphenylglycine, due to the shortcomings of low catalytic efficiency and poor stability of DCase, the intermediate N-carbamoyl-D-p-hydroxyphenylglycine accumulates in large quantities, and the final product D-hydroxyphenylglycine Low yield of glycine
[0005] Although natural enzyme molecules have evolved for millions of years under natural conditions, because the environment in which natural enzyme molecules exist is different from the actual application environment, enzyme molecules still have huge evolution potential

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants and construction of engineering bacteria thereof
  • N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants and construction of engineering bacteria thereof
  • N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants and construction of engineering bacteria thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, the cloning of N-carbamoyl-D-p-hydroxyphenylglycine hydrolase gene

[0033] 1.1 PCR amplification

[0034] Primer design

[0035] DCase-F1: CGGGATCCGCTCGTCAGATGATATTCGCAG

[0036] DCase-R1: CTTACGATACTTGCCGACGATCTTG

[0037] DCase-F2: CAAGATCGTCGGCAAGTATCGTAAG

[0038] DCase-R2: GAGATGGTGGAAGGACGTCAGGTGG

[0039] DCase-F3: CCACCTGACGTCCTTTCCACCATCTC

[0040] DCase-R3: CCCAAGCTTGAGTTCCGCGATCAGACC

[0041] Using the pET28a-DCase plasmid as a template, PCR amplification was performed using primers DCase-F1 and DCase-R3. Amplification system: 2×PCR mix 10μl, dd H 2 O 8 μl, template DNA 1 μl (about 50ng-200ng), upstream and downstream primers 0.5 μl each (concentration 20 μM).

[0042] The PCR reaction conditions were: 96°C, 2min pre-denaturation; 96°C, 1min denaturation, 50°C, 30s annealing, 72°C extension 1min (30 cycles); finally 72°C extension 5min, 4°C storage.

[0043] 1.2 Construction of a plasmid containing N-carbamoyl-D-p-hydroxyphenylglycine hy...

Embodiment 2

[0048] Example 2, Directed mutation of N-carbamoyl-D-p-hydroxyphenylglycine hydrolase expression gene

[0049] 2.1 Primer design

[0050] DCase-F1: CGGGATCCGCTCGTCAGATGATATTCGCAG

[0051] DCase-R1: CTTACGATACTTGCCGACGATCTTG

[0052] DCase-F2: CAAGATCGTCGGCAAGTATCGTAAG

[0053] DCase-R2: GAGATGGTGGAAGGACGTCAGGTGG

[0054] DCase-F3: CCACCTGACGTCCTTTCCACCATCTC

[0055] DCase-R3: CCCAAGCTTGAGTTCCGCGATCAGACC

[0056] Using the pET28a-DCase recombinant as a template, use primers DCase-F2 and DCase-R2 for error-prone PCR amplification, error-prone PCR reaction system (50ul): template gene 20ng, upper and lower primers 300pmol each, dATP0.2mm, dGTP0.2mm , dCTP1mm, dTTP1mm, MgCl 2 7mm, MnCl 2 0.1mm, Taq enzyme 2.5U (Tiangen Biochemical Technology Co., Ltd.).

[0057] The PCR conditions were: 96°C, 5min pre-denaturation; 96°C, 30s denaturation, 50°C, 30s annealing, 72°C extension 30s (30 cycles); finally 72°C extension 5min, 4°C storage.

[0058] 2.2 Construction of plasmid c...

Embodiment 3

[0068] Example 3, Screening of N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutation library

[0069] 3.1 Construction of engineering bacteria containing N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutation library

[0070] Use a plasmid extraction kit (Beijing Kangwei Century Biotechnology Co., Ltd.) to extract recombinant plasmids, and then transform them into E.coli BL21 (Beijing Quanshijin Biotechnology Co., Ltd.) according to conventional methods. The transformed cells are coated on LB containing ampicillin antibiotics. Plates (tryptone 1%, yeast extract 0.5%, sodium chloride 1%, agar 1.5%) were cultured at 37°C.

[0071] 3.2 Screening and identification of N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants

[0072] Pick a single colony and culture it on a 96-well plate containing 200 ul of kana antibiotics (50 ug / ml). When the OD600 reaches 0.6, add 1 MIPTG to make the final concentration 0.2 mM, and culture overnight at 18 ° C.

[0073] Take out 150ul bacteri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants and construction of engineering bacteria thereof. The differences between 5 mutants obtained by orthogenesis and N-carbamoyl-D-p-hydroxyphenylglycine hydrolase respectively lie in that: cysteine at position 193 in an amino acid sequence of N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutates into asparagine; threonine at position 200 mutates into alanine; asparagine at position 226 mutates into tyrosine; cysteine at position 243 mutates into asparagine; cysteine at position 250 mutates into tyrosine; and engineering bacteria construction is carried out, and the N-carbamoyl-D-p-hydroxyphenylglycine hydrolase mutants and engineering bacteria are applied in D-p-hydroxyphenylglycine production. Compared with wild enzyme, the tolerance to oxygen, tolerance to acid-base and the enzyme activity are greatly improved.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a mutant encoding N-carbamoyl-D-p-hydroxyphenylglycine hydrolase and the construction of engineering bacteria thereof. Background technique [0002] D-amino acid and its derivatives are important raw materials in the field of medicine and food, and are widely used as intermediates of semi-synthetic antibiotics, polypeptide hormones, pyrethroids, insecticides and sweeteners, etc., thus causing more and more Interests, especially as the side chain raw material of semi-synthetic antibiotics - D-amino acid has attracted more attention. D-p-Hydroxyphenylglycine (D-p-HPG) is an important raw material for the preparation of β-lactam antibiotics (such as penicillins and cephalosporins) and the main side chain for the synthesis of various polypeptide hormones and pesticides, and is widely used in the field of pharmacy. [0003] As an unnatural amino acid, D-p-hydroxyphenylglycine canno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/80C12N15/55C12N15/63C12N1/21C12P13/04
CPCC12N9/80C12P13/04
Inventor 赵德杨兆勇任丽任敏李亚东金媛媛王国勤罗尚菊易丹王翠娟
Owner CHONGQING HONOROAD ANIMAL HEALTH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com