Transcription activator like effector nuclease and application thereof
A technology of transcriptional activators and effectors, applied in the field of bioengineering, can solve problems such as the need to improve the expression of GHR
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1: Construction and activity detection of TALEN vector (cleavage construct) for identifying GHR gene locus
[0048] Vector build:
[0049]Analyze the GHR site sequence, select TCCTTGTCAGAGCATCTCAGAGTCTGCAGAGAGTTCATCCAGGCCTAGAGA (SEQ ID NO: 1) as the TALEN vector recognition splicing sequence, SEQ ID NO: 1 recognizes a sequence of exon 2 of the GHR gene, and there is a natural PstI restriction site in the middle of the recognition sequence, which can For enzyme digestion identification. Specifically, TALEN1 recognizes TCCTTGTCAGAGCATCTC (SEQ ID NO: 2), that is, the sequence of assembled TALEN1 modules is: HD-HD-NG-NG-NN-NG-HD-NI-NN-NI-NN-HD-NI-NG-HD- NG-HD (SEQ ID NO: 7); TALEN2 recognizes the reverse complementary sequence of TCATCCAGGCCTAGAGA (SEQ ID NO: 3), and the module sequence for assembling TALEN2 is: HD-NG-HD-NG-NI-NN-NN-HD-HD-NG- NN-NN-NI-NG-NN-NI (SEQ ID NO: 8).
[0050] Then, construct the TALEN expression backbone vector according to the following...
Embodiment 2
[0062] Example 2: Transfection screening and identification of GHR target cells
[0063] Extract endotoxin-free TALENs plasmid and pcDNA3.1(+). The pcDNA3.1(+) vector was digested with AhdI to linearize it. The TALENs plasmid and pcDNA3.1(+) linearized fragment were co-transfected into Bama pig fetal fibroblasts by nuclear transfer method, and the transfection ratio was 2 μg TALENs:0.8 μg pcDNA3.1(+) linearized fragment.
[0064] Divide the transfected cells to 10cm, and use 500μg / ml G418 to screen the cells. After 1 week of screening, positive clones appear, pick the positive clones to a 48-well plate and continue to expand the culture, and change the concentration of 200μg / ml G418 maintain. It should be noted that the lethal concentration of G418 is different for different cell lines, so the lethal concentration of G418 must be measured for the cell lines first. The lethal concentration of G418 for the Bama fibroblast cell line in this example is 500 μg / ml.
[0065] Cells...
Embodiment 3
[0075] Example 3 Manual cloning to obtain transgenic piglets
[0076] The specific process is as follows:
[0077] Obtain the Bama pig ovary, collect the ovum, and wash it in the improved TL-Hepes-PVA buffer, put it into a culture plate, and carry out in vitro maturation (invitromaturation, IVM) culture of immature egg cells in an incubator to obtain mature eggs. Among them, the formula of the improved TL-Hepes-PVA buffer is: 114MNaCl, 3.2MKCl, 0.34MNaH 2 PO 4 , 10M sodium lactate, 0.50MMgCl 2 ·6H 2 O, 10M Hepes, 0.2M Sodium Pyruvate, 12M Sorbitol, 2M Na 2 HCO 3 , 2MCaCl 2 2H 2 O, 0.01 volume % PVA.
[0078] Then, the obtained mature eggs are enucleated with a small blade under a microscope to obtain mature enucleated oocytes. Next, pick a single GHR-16 clone cell line cell, and fuse it into a mature enucleated oocyte using a fusion instrument to make a reconstructed embryo. Then the reconstituted embryos are put into the incubator and cultured for 5-6 days to form ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com