Molecular marker for rice blast resistance gene Pita and application thereof
A molecular marker and resistance gene technology, applied in the field of plant biology, can solve problems such as high cost and time-consuming detection, and achieve the effects of strong specificity, improved detection efficiency, and improved breeding efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Rice Pita Primer Design and Amplified Fragment Analysis of Gene Functional Marker Pita-G / T
[0033] 1. Primer design
[0034] rice blast resistance gene Pita In different rice varieties, the sequence comparison of the disease-resistant and susceptible alleles showed that there was a G / T SNP variation at the 918th amino acid position in the coding region of the disease-resistant and susceptible alleles. Functional marker Pita-G / T covering differential sites ( figure 1 ). The Pita-G / T is composed of 4 primers Pita-T-F, Pita-G-R, Pita-O-F and Pita-O-R, and the primer sequences (5'-3') are as follows:
[0035] Pita-T-F: TCTGCCGTGGCTTCTATCTTTAC T TT
[0036] Pita-G-R: AAGTCAGGTTGAAGATGCAT G GC
[0037] Pita-O-F: CTCTTATGGTTGATATACAATGGGTGGA
[0038] Pita-O-R: ACCTCTACTCTGAAGACGTGAAGAGGA
[0039] The underlined bases in the primer sequence are the introduced mismatched bases, and the framed bases are the variant bases to be detected....
Embodiment 2
[0042] Example 2 Rice Pita Identification of 7 Rice Disease Resistance Genotypes by Gene Functional Marker Pita-G / T
[0043] 1. Extraction of rice genomic DNA
[0044] Seven rice varieties were used as materials: Minghui 63, Shengba Simiao, Hanghui No.7, Guanghui 998, Nipponbare, Huazhan and Shengba Simiao / Hanghui No.7. Select the young leaves of a single rice plant, and use the CTAB method to extract rice genomic DNA. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and put them in a 2 mL centrifuge tube and add liquid nitrogen to mash them. Add 1 mL of CTAB extract to the centrifuge tube. , shake well; (2) Place in a water bath or incubator at 65°C, shake gently every 10 minutes, take it out after 30-45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1 ) until the tube is full, shake vigorously up and down to mix the two evenly; (4) put the centrifuge tube into a centrifuge at 15,000 r / min for 10 min and t...
Embodiment 3
[0065] Example 3 Application example of rice functional marker Pita-G / T method
[0066] 1. Testing materials: 47 rice germplasm materials from different sources were selected.
[0067] 2. Extraction of rice genomic DNA: same as Example 2.
[0068] 3. Amplification of functional marker Pita-G / T: same as Example 2.
[0069] 4. Capillary electrophoresis detection and genotype determination of amplified products
[0070] The amplified product was diluted and transferred to Fragment AnaLyzer? Automated CE System (ATI, USA) for detection, followed the operation manual of the kit DNF-910-K2000, and used PROSize? 2.0 data analysis software for data analysis. type to judge:
[0071] The amplified products are two fragments of 309 bp and 202 bp, showing that the genotype of the marker individual is G / G homozygous, such as image 3 The 3rd, 6th, 9th, 14th, 16th to 18th, 21st to 22nd, 24th to 25th, 28th to 30th, 34th, 40th, 42th to 43rd, 45th to 46th detection sample...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap