Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for rice blast resistance gene Pita and application thereof

A molecular marker and resistance gene technology, applied in the field of plant biology, can solve problems such as high cost and time-consuming detection, and achieve the effects of strong specificity, improved detection efficiency, and improved breeding efficiency.

Inactive Publication Date: 2015-07-22
SOUTH CHINA AGRI UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the limitations of these markers in terms of stability, detection efficiency, and cost, for example, CAPS needs to perform PCR amplification, enzyme digestion, and electrophoresis to separate enzyme-digested fragments, resulting in time-consuming and high-cost detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for rice blast resistance gene Pita and application thereof
  • Molecular marker for rice blast resistance gene Pita and application thereof
  • Molecular marker for rice blast resistance gene Pita and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Rice Pita Primer Design and Amplified Fragment Analysis of Gene Functional Marker Pita-G / T

[0033] 1. Primer design

[0034] rice blast resistance gene Pita In different rice varieties, the sequence comparison of the disease-resistant and susceptible alleles showed that there was a G / T SNP variation at the 918th amino acid position in the coding region of the disease-resistant and susceptible alleles. Functional marker Pita-G / T covering differential sites ( figure 1 ). The Pita-G / T is composed of 4 primers Pita-T-F, Pita-G-R, Pita-O-F and Pita-O-R, and the primer sequences (5'-3') are as follows:

[0035] Pita-T-F: TCTGCCGTGGCTTCTATCTTTAC T TT

[0036] Pita-G-R: AAGTCAGGTTGAAGATGCAT G GC

[0037] Pita-O-F: CTCTTATGGTTGATATACAATGGGTGGA

[0038] Pita-O-R: ACCTCTACTCTGAAGACGTGAAGAGGA

[0039] The underlined bases in the primer sequence are the introduced mismatched bases, and the framed bases are the variant bases to be detected....

Embodiment 2

[0042] Example 2 Rice Pita Identification of 7 Rice Disease Resistance Genotypes by Gene Functional Marker Pita-G / T

[0043] 1. Extraction of rice genomic DNA

[0044] Seven rice varieties were used as materials: Minghui 63, Shengba Simiao, Hanghui No.7, Guanghui 998, Nipponbare, Huazhan and Shengba Simiao / Hanghui No.7. Select the young leaves of a single rice plant, and use the CTAB method to extract rice genomic DNA. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and put them in a 2 mL centrifuge tube and add liquid nitrogen to mash them. Add 1 mL of CTAB extract to the centrifuge tube. , shake well; (2) Place in a water bath or incubator at 65°C, shake gently every 10 minutes, take it out after 30-45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1 ) until the tube is full, shake vigorously up and down to mix the two evenly; (4) put the centrifuge tube into a centrifuge at 15,000 r / min for 10 min and t...

Embodiment 3

[0065] Example 3 Application example of rice functional marker Pita-G / T method

[0066] 1. Testing materials: 47 rice germplasm materials from different sources were selected.

[0067] 2. Extraction of rice genomic DNA: same as Example 2.

[0068] 3. Amplification of functional marker Pita-G / T: same as Example 2.

[0069] 4. Capillary electrophoresis detection and genotype determination of amplified products

[0070] The amplified product was diluted and transferred to Fragment AnaLyzer? Automated CE System (ATI, USA) for detection, followed the operation manual of the kit DNF-910-K2000, and used PROSize? 2.0 data analysis software for data analysis. type to judge:

[0071] The amplified products are two fragments of 309 bp and 202 bp, showing that the genotype of the marker individual is G / G homozygous, such as image 3 The 3rd, 6th, 9th, 14th, 16th to 18th, 21st to 22nd, 24th to 25th, 28th to 30th, 34th, 40th, 42th to 43rd, 45th to 46th detection sample...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant biology, and particularly discloses a molecular marker for a rice blast resistance gene Pita and application thereof. The molecular marker consists of a pair of outer primers Pita-O-F and Pita-O-R and a pair of inner primers Pita-T-F and Pita-C-R, wherein the primer sequences are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. The rice blast resistance gene Pita genotype is authenticated by utilizing the marker; rice blast resistance genes can be genotyped to distinguish a rice blast fungus resistant rice variety from a susceptible variety only through simple PCR without sequencing; auxiliary selection of the molecular marker of a rice blast can be realized; according to the molecular marker disclosed by the invention, the Pita gene detecting efficiency can be improved; the molecular marker is suitable for the molecular marker auxiliary selection of a rice improvement segregation population; the breeding efficiency is improved; the requirement on large-scale molecular breeding is met.

Description

technical field [0001] The invention relates to the field of plant biotechnology, more specifically, to a rice blast resistance gene Pita molecular markers and their applications. Background technique [0002] Rice blast is one of the main diseases that cause serious rice production reduction, and the annual production loss due to rice blast accounts for about 10-15% of the total production. At present, discovering broad-spectrum rice blast resistance genes or major QTLs, and cultivating rice varieties with broad-spectrum and long-lasting disease resistance through aggregate breeding are the main measures to control rice blast. Therefore, the detection of rice blast resistance genes and the screening of blast resistance rice germplasm are particularly important. [0003] Pita The gene is a rice blast resistance gene with broad-spectrum resistance that has been cloned so far. It is located in the pericentromere region of rice chromosome 12, contains 2 exons and 1 intron o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895
Inventor 王加峰陈立凯罗文龙黄翠红郭涛陈志强王慧
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com