Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wheat TaSPL6 gene and application thereof

A wheat and gene technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as unclear biological function and molecular basis

Active Publication Date: 2015-07-22
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wheat is an important food crop for humans, but little is known about the structural and functional analysis of the SPL gene family in wheat, and the biological function and molecular basis of the gene in wheat are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat TaSPL6 gene and application thereof
  • Wheat TaSPL6 gene and application thereof
  • Wheat TaSPL6 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Cloning of wheat TaSPL6 gene

[0040] 1. Extraction of total RNA from wheat leaves

[0041] Plant RNeasy Kit (Qiagen) was used to extract total RNA from leaves of Chinese spring wheat (Triticum aestivum L.).

[0042] 2. Synthesis of the first fragment of TaSPL6 gene cDNA

[0043] Follow the instructions for reverse transcriptase M-MLV (TaKaRa).

[0044] 3. Cloning the coding region sequence of TaSPL6 from the cDNA of Chinese spring wheat (Triticum aestivum L.) leaves; the forward and reverse primer sequences are shown in SEQ ID NO.4-5.

[0045] PCR program: 94°C, 5min; 94°C, 30s; 56°C, 30s; 72°C, 3min; repeat 35 times; 72°C, 10 minutes.

[0046] PCR system:

[0047]

[0048] After the PCR product was cut and purified, it was cloned and ligated to the pEASY-T1Simple vector according to the pEASY-T1Simple Cloning Kit cloning method provided by Beijing Quanshijin Biotechnology Co., Ltd., and the ligation product was transformed into E. coli DH5α and expanded in it. The positi...

Embodiment 2

[0049] Example 2 Chromosome location of wheat TaSPL6 gene

[0050] According to the TaSPL6 gene obtained in Example 1, homologous chromosomal sequences in A, B, and D, after comparative analysis, it was found that the three nucleotide sequences had polymorphisms. Design 3 pairs of specific primers, using the DNA of the Chinese spring tetrasomy as a template, perform PCR reaction, and locate the position of TaSPL6 gene in the chromosome by agarose gel electrophoresis.

[0051] The 3 pairs of specific primers are:

[0052] The SNP molecular marker for detecting wheat TaSPL6A gene was amplified by the following primers:

[0053] SPL6A-F-primer TTGCTCTAGGGTTTCGTC

[0054] SPL6A-R-primer TACACCTAACCTTATTTCG;

[0055] The SNP molecular marker for detecting wheat TaSPL6B gene was amplified by the following primers:

[0056] SPL6B-F-primer CGGGAATTCGATTGTGCTT

[0057] SPL6B-R-primer TCCTAACCTTATTTCGACCC;

[0058] The SNP molecular marker for detecting the wheat TaSPL6D gene was amplified by the fo...

Embodiment 3

[0063] Example 3 Transcriptional activation experiment of wheat TaSPL6 gene in yeast

[0064] 1. Yeast AH109 Competent Preparation (It is best to use it now)

[0065] Yeast AH109 was streaked on the YPDA solid medium, then the single clone was picked and mixed in 1ml YPDA, then transferred to 50ml YPDA, 30℃, 220rpm shake for 16-18h, to OD 600 > 1.5. Take 30ml of shaken bacteria into 300ml YPDA and detect OD 600 , Adjust OD 600 Between 0.2-0.3. Then shake the bacteria at 30℃, 200rpm for 3h, to OD 600 Between 0.4-0.6 (if OD 600 2 O thoroughly resuspend the pellet (final volume 25-50ml). Centrifuge at 1000 g for 5 min at room temperature, and discard the supernatant. Resuspend the bacteria with 1ml sterile 1×TE / 1×LiAc solution, divide them into 1.5ml centrifuge tubes, and store 100μl per tube at -80℃ for later use.

[0066] 2 Yeast transformation

[0067] Take 100μl yeast competent on ice, add 5μl vector plasmid (pEASY-T1Simple vector and gene TaSPL6B positive clone plasmid, about 1μg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a wheat TaSPL6 gene and application thereof, and belongs to the field of crop molecular biology. According to the wheat TaSPL6 gene and the application thereof, the specific primers are used for cloning the coding region sequences of the TaSPL6 from cDNA of leaves of Triticum aestivum L.; nulli-tetrasome is utilized to position TaSPL6 on the wheat fifth homologous group; the sequences of the coding region sequences of the TaSPL6 gene are respectively as shown in SEQ ID NO.1-3. Through transforming arabidopsis by the TaSPL6 gene, the result proves that the gene is capable of enlarging the Arabidopsis leaves and increasing the biomass.

Description

Technical field [0001] The present invention relates to the field of crop molecular biology and molecular breeding, and more specifically, to the wheat TaSPL6 gene and its location in the chromosome, and the application of the gene. Background technique [0002] As an important food crop, wheat has 35%-40% of the world’s main food. At the same time, as one of the three major cereals, almost all of its output is used for food. It is the world's food crop second only to corn in total output. With the completion of the whole genome sequencing of many plants, including rice and corn, human beings have entered the era of functional genes. The use of target genes with known functions in the species for sequence comparison and analysis, and the use of highly conserved sequences for primer design and homologous sequence cloning of the studied species are one of the common methods for discovering new genes. [0003] SPL (squamosa promoter binding protein-like) is a type of plant-specific ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/11C12N15/10C12N15/82A01H5/00C12Q1/68
Inventor 毛龙李爱丽王炳南耿帅锋冯楠
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com