Application of miR-425 in tumor diagnosis, treatment and prognosis

A mir-425, 1.mir-425 technology, applied in the application field of miR-425 in the diagnosis, treatment and prognosis of tumors, can solve the problem of poor curative effect and insignificant survival rate of patients with middle-advanced and metastatic recurrence Improve other problems, achieve the effect of inhibiting proliferation and metastasis, enhancing sensitivity, and reducing cell proliferation

Active Publication Date: 2015-06-24
SUN YAT SEN UNIV CANCER CENT
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Up to now, surgical resection and liver transplantation have been considered as the means of radical treatment for liver cancer. Significant progress has been made in liver resection technology, and postoperative complications and mortality have also been significantly reduced. However, the postoperative 5-year survival rate is marked by The survival rate of patients has not improved fundamentally
Although the traditional treatment plan can alleviate the condition of patients in the early stage, it is less effective for patients with advanced stage and metastatic recurrence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-425 in tumor diagnosis, treatment and prognosis
  • Application of miR-425 in tumor diagnosis, treatment and prognosis
  • Application of miR-425 in tumor diagnosis, treatment and prognosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: miR-425 is upregulated in tumor samples

[0047] 1. TCGA database analysis

[0048] Methods: All statistical analyzes were processed with SPSS17.0 statistical software. The independent t-test (constant variable) was used for comparison between different groups, the t-test was used for the comparison of means between two groups, and the χ test was used for the comparison of categorical variables 2 One-way analysis of variance was used for comparison among multiple groups. Values ​​are expressed as mean ± SD. test coefficient P < 0.05 was considered a statistically significant difference. Lung cancer, liver cancer, bladder cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck squamous cell carcinoma, kidney cancer, prostate cancer and ovarian cancer were analyzed by SPSS statistical analysis method in TCGA (The Cancer Genome Altas Project) database. The expression of miR-425 in cancer microRNA expression profiling...

Embodiment 2

[0059] Example 2: Construction of cell lines stably and highly expressing miR-425 and cell lines transfected with antimiR-425.

[0060] 1. Construction of a stable cell line with high expression of miR-425

[0061] (1) Construct the expression plasmid of miR-425

[0062] The full-length cDNA sequence of the miR-425 precursor was amplified by PCR, and the primer sequences were as follows:

[0063] FP: GCCAGATCTGCAACGGAATCCCAAAA (SEQ ID NO: 6)

[0064] RP: GCCGAATTCCAAATAATGCGACCATAATAGAA (SEQ ID NO: 7)

[0065] The purified full-length sequence of miR-425 was constructed into the pMSCV-retro-puro expression vector (purchased from Clontech Company) to obtain the miR-425 overexpression plasmid pMSCV-retro-puro-miR-425.

[0066] (2) Transfect human lung cancer cell A549 and liver cancer cell HepG2

[0067]The obtained pMSCV-retro-puro-miR-425 and the control pMSCV-retro-puro empty vector were transformed into 293FT cells by using Lipofectamine2000 (Invitrogen, #11668) and ...

Embodiment 3

[0074] Example 3: Functional research of miR-425 in lung cancer cells and liver cancer cells

[0075] 1. Detection of Tumor Cell Proliferation

[0076] (1) In vitro experiment: cell growth experiment

[0077] MTT [3-4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide assay was used to detect the changes in the growth rate of cells with high miR-425 expression and miR-425 silence. The experimental operation was carried out according to the instructions of the cell proliferation MTT kit (Roche, Mannheim). The brief description is as follows: the experimental group cells (HepG2-miR-425 and HepG2-antimiR-425) or the control group cells (HepG2-VectorA and HepG2-Control) were divided into 1×10 4 Cells / well were inoculated in 24-well culture plates, and 100 μL of MTT labeling mixture with a concentration of 10.3 mg / mL was added to a group of cells every 24 hours, and the absorbance was measured with a microplate reader (Tecan) after 4 hours of incubation ( OD value...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of miR-425 in tumor diagnosis, treatment and prognosis. Multiple biological characteristics of tumor including apoptosis, proliferation, drug susceptibility and the like disclosed by the invention are closely related to the expression quantity of miR-425. MiR-425 antagonist antimiR-425 can be used for significantly inhibiting proliferation of multiple types of tumor cells and the tumorigenic ability of the tumor cells in a nude mouse, and enhancing the tumor treatment capacity of chemotherapy drug cisplatin and the like in the nude mouse. The invention discloses a kit for tumor assisted diagnosis and patient survival prognosis, and the kit contains a primer sequence for the quantitative determination of miR-425; the invention also discloses a pharmaceutical composition for treating tumor, wherein the composition contains the miR-425 antagonist antimiR-425. The invention provides a novel method for assisted diagnosis and prognosis diagnosis of cancer. The invention discovers that the antimiR-425 has high clinical application value in the preparation of a tumor-treating medicine, and particularly provides a novel medicine and a treatment method for the effective treatment of lung cancer and liver cancer.

Description

technical field [0001] The invention relates to the application of miR-425 in tumor diagnosis, treatment and prognosis. Background technique [0002] Malignant tumor is a disease that seriously endangers human life and health. In my country, about 3.07 million people suffer from cancer every year, and about 2.2 million people die from cancer every year. According to the 2012 World Cancer Report of the World Health Organization, there were 3.07 million newly diagnosed cancer cases in China, accounting for 21.8% of the global total; and 2.2 million annual deaths, accounting for 26.9% of the global annual cancer deaths. What's more serious is that these data are increasing year by year at an alarming rate. Malignant tumors have surpassed cardiovascular disease as the leading cause of death. Therefore, it is of great significance to human health to explore the molecular mechanism of cancer and find its effective treatment. [0003] According to the data released by the World ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68A61K48/00A61P35/00
CPCC12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 宋立兵李隽林楚勇周心怡刘爱斌吴淑
Owner SUN YAT SEN UNIV CANCER CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products