Supercharge Your Innovation With Domain-Expert AI Agents!

In-vitro mini-reporter gene used for predicating androgen receptor posttranscriptional modification sites and application thereof

A post-transcriptional modification, androgen receptor technology, applied in the field of molecular biology, to achieve high efficiency, sensitivity and specificity, accurate verification and blocking, and practical clinical application value

Inactive Publication Date: 2015-05-06
SHANGHAI TONGJI HOSPITAL
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is a technical method that cannot be replaced by other methods at present, and there has been no relevant report so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In-vitro mini-reporter gene used for predicating androgen receptor posttranscriptional modification sites and application thereof
  • In-vitro mini-reporter gene used for predicating androgen receptor posttranscriptional modification sites and application thereof
  • In-vitro mini-reporter gene used for predicating androgen receptor posttranscriptional modification sites and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] AR3 mini reporter gene plasmid ( figure 1 ), which consists of the following primer sequence clones:

[0062] pCDH-Myc-R1-AR3-E3-5.1 (SEQ ID NO.1):

[0063] CCATGGAGGCCCGAATTCTGGGGAAACAGAAGTACCTGTGC

[0064] AR-I3-5.2+I3-3.1-R (SEQ ID NO.2):

[0065] CTGGGTGGCTGCGTGTTTTTTAAACTAGATCTGCCTGACT

[0066] AR-I3-5.2+I3-3.1-F (SEQ ID NO.3):

[0067] AGTCAGGCAGATCTAGTTTAAAAAACACGCAGCCACCCAG

[0068] AR3-mC-5.1 (SEQ ID NO.4):

[0069] TGACTTGCCTCATTCAAAAGTGGTGAGCAAGGGCGAGGAG

[0070] AR3-mC-3.1 (SEQ ID NO.5):

[0071] CTCCTCGCCCTTGCTCACCACTTTTGAATGAGGCAAGTCA

[0072] mC-pCDH-Sal1-3.1 (SEQ ID NO.6):

[0073] TCCAGAGGTTGATTGTCGACTTACAGCTCGTCCATGCCGC

[0074] The isoform AR3 mini-reporter gene (AR3mini gene cassette mCherry reporter) of the androgen receptor (AR) was constructed according to the following method:

[0075] PCR method was used to amplify the exon exon3 (E3) and part of the intron (about 2.3kb) sequence of AR using human genomic DNA as a template. The primer...

Embodiment 2

[0076] Embodiment 2 Real-time quantitative PCR detects the expression levels of PCGEM1 and AR3 ( figure 2 )

[0077] The expression level of a target gene can be routinely determined using, eg, quantitative PCR, ribonuclease protection assays. The following cell types are provided for example, but other cell types can be routinely used provided the target is expressed in the cell type of choice.

[0078] LNCaP cells are cultured in a suitable medium as described below and maintained at 37 °C, 95-98% humidity and 5% CO 2 middle. When cultured under hypoxia or hypoxia, O 2 Levels remain at 1-2% or 0-0.5%, respectively. Cells were routinely passaged 2-3 times a week.

[0079] (1) Collect cells.

[0080] (2) Extracting the total RNA in the cells. The RNA extraction kit (AM1560) of Ambion Company was used, and the operation was performed according to the instructions of the kit.

[0081](3) Take 100ng of total RNA and perform reverse transcription.

[0082] (4) Take the p...

Embodiment 3

[0092] Example 3 PCGEM1 participates in the regulation of AR3 post-transcriptional modification expression ( image 3 )

[0093] (1) LNCaP cells were cultured with 1640 medium plus 10% FBS until the cell density reached 50%.

[0094] (2) Use RNA transfection reagent to transfect PCGEM1-LNA and NC according to the routine operation method in the manual, and the final concentration reaches 50 nM. Wherein, the PCGEM1-LNA sequence is A+T+T+CCCCTCAGA+A+ATCTCAGGGCTT+G+T+C, wherein + is selected from any one of β-D-oxygen-LNA nucleotide analogues. The purpose of transfecting PCGEM1-LNA is to observe the effect on AR3 expression by down-regulating the expression of PCGEM1.

[0095] (3) After the transfection time reaches 12 hours, replace with fresh medium and continue to culture for 24 hours.

[0096] (4) Aspirate the medium, collect the cells and extract the total RNA, and detect the expression of AR3 regulated by PCGEM1 by northtern. For the specific operation method, see "Zhang...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an in-vitro mini-reporter gene used for predicating androgen receptor posttranscriptional modification sites and an application thereof. Experiments indicate that lncRNA PCGEM1 directly decides castration resistance or recurrence and metastasis of hormones for expressing the tumours of an androgen receptor after castration by regulating the posttranscriptional modification of the isomer AR-V7(AR3) pre-mRNA of the androgen receptor; on this basis, sequences containing exons Exon3 and Exon4 of the pre-mRNA of the AR are selected to construct the mini-reporter gene through gene cloning; on one hand, the mini-reporter gene is used for predicating high-risk factors causing the hormone castration recurrence and metastasis of the tumours related to the androgen receptor, such as prostatic cancer; on the other hand, the expression and action of the specific target gene sites can be intuitively, efficiently and accurately verified and blocked through the mini-reporter gene.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to an in vitro mini-reporter gene for prediction of androgen receptor post-transcriptional modification sites and its application. Background technique [0002] Cancer accounts for nearly a quarter of human deaths. Tumor recurrence and metastasis have remained a major obstacle to improving overall survival over the past few decades, which may be largely attributed to the still lack of a comprehensive understanding of cancer biology. For example, recent advances in functional genomics studies have shown that the vast majority of non-coding RNAs involved in human gene transcription include long non-coding RNAs (lncRNAs). However, little is known about the role of lncRNAs in regulating cancer gene expression and mechanisms [1]. [0003] Recently, through the study of tumor epigenetic mechanisms, we found that lncRNAs can regulate tumor progression through multiple mechanism...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11A61K48/00A61P35/00C12Q1/68
Inventor 张子强Y·莫邱忠民朱竹先吕寒静
Owner SHANGHAI TONGJI HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More