Anti-HER2 polyclonal antibody as well as preparation method and application thereof
A polyclonal antibody and protein technology, applied in the field of bioengineering, can solve the problems of clinical prognosis, recurrence or metastasis of tumor recurrence, and achieve high specificity and high sensitivity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Preparation of polyclonal antibody IgY
[0036] 1.1 Preparation of immunogen
[0037] 1.1.1 According to the HER2 gene sequence, self-designed primers:
[0038] Upstream primer: CGAGCTCATGGAGCTGGCGGCCTTGTGCCGCT, downstream primer: CCGCTCGAGTTACGTCAGAGGGCTGGCTCTCTGCT, using HER2 DNA as a template, amplify the target gene by PCR, construct a recombinant plasmid, transform Escherichia coli, and induce the expression of HER2 protein expressed in inclusion bodies. and chromatographic purification to obtain high-purity antigenic protein HER2.
[0039] 1.1.2 Freund's complete adjuvant (FCA) was used for the first immunization, and Freund's incomplete adjuvant (FIA) was used for booster immunization.
[0040] 1.1.3 Freund's complete adjuvant (FCA) preparation
[0041] 1.1.3.1 The volume ratio of light liquid paraffin and Span-80 is 85:15.
[0042] For example, to prepare 200mL FCA, take light liquid paraffin 170mL×0.847 (relative density)=144g; Span-80: 30mL×0.969 (relative...
Embodiment 2
[0092] Polyclonal antibody IgY titer detection
[0093] 2.1 Detection of IgY titer by ELISA method
[0094] ELISA indirect method was used to detect the titer of IgY, and the procedure was as follows:
[0095] 1) Dilute the HER2 antigen to a concentration of 5 μg / mL with 50 mM carbonate buffer, add to a microtiter plate, 120 μL per well, seal, and coat overnight at 4°C;
[0096] 2) Take out the next day, shake off the coating solution, buckle dry on absorbent paper, add blocking solution, 250 μL per well, the blocking solution is 1% BSA dissolved in PBST, seal, and block overnight at 4 °C;
[0097] 3) Take it out the next day, wash the plate 3 times, dry it on absorbent paper, and dry at 37°C for 30 minutes;
[0098] 4) The polyclonal egg yolk antibody IgY freeze-dried powder obtained in Example 1 was dissolved in PBST at 1 mg / mL, and then 2-fold serial dilution was performed with PBST as a starting point, and the sample to be tested diluted according to this was added, and ...
Embodiment 3
[0108] Application of Immunohistochemical Method in Detecting HER2 Antigen
[0109] 3.1 Preparation of HER2 immunohistochemical diagnostic kit method
[0110]3.1.1 Preparation of IgY antibody: The purified polyclonal egg yolk antibody IgY (see Example 1 for the purification method) was dissolved in sterilized PBS to a concentration of 2 mg / mL, added sterile glycerol at a ratio of 1:1, and stored in -80℃ low temperature refrigerator.
[0111] 3.1.2 Establishment of immunohistochemical detection method for HER2: through the optimization of immunohistochemical test conditions, a qualitative detection method for HER2 was established. The specific steps are as follows:
[0112] 1) Slice, the thickness of each slice is 4 μm, bake at 60°C for 2-3 hours or overnight;
[0113] 2) Xylene dewaxing 3 times, each 10min;
[0114] 3) Gradient alcohol dexylene to hydration (100%→90%→75%→50%), each for 5 minutes;
[0115] 4) Washing: wash with PBS 3 times, 5 min each;
[0116] 5) Enzyme b...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com