Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Simple, convenient, sensitive and general gene detecting method

A gene detection, general-purpose technology, applied in the field of functional nanomaterials and biochemistry, can solve the problems of complex operation and limited sensitivity of gene detection methods, and achieve the effect of high application potential, high yield and long life.

Inactive Publication Date: 2014-06-25
SUZHOU UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a simple, sensitive and universal gene detection method, which aims to solve the problems of complicated operation and limited sensitivity of current gene detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Simple, convenient, sensitive and general gene detecting method
  • Simple, convenient, sensitive and general gene detecting method
  • Simple, convenient, sensitive and general gene detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: A Simple, Sensitive and Universal Gene Detection Method

[0043] The detection method of the concentration of the target gene to be tested can be found in figure 1 shown. In this embodiment, an artificially synthesized DNA is used as the target gene to be tested.

[0044] In the first step, the DNA probe sequence is designed according to the target gene sequence to be tested, and the DNA (sequence is 5'- GGTCGGTGCAAAGATACGTACG AGGACA-3') as the target gene to be tested, design probes (sequence is 5'-GCTTTGA CGTACGTATCTTTGCACCGACC -3'), while DNA containing a single mutant base (sequence is 5'- GGTCGGTGCAAAGCTACGTACG AGGACA-3') as a control, where the bold letter in the probe sequence is the stem structure, which contains T-T base pairs, the underlined part is the pairing region between the probe and the target gene to be tested, and the bold and italic letter C is a single mutation base;

[0045] In the second step, mix the probe (containing three T-T...

Embodiment 2

[0051] Example 2: A Simple, Sensitive and Universal Gene Detection Method

[0052] A simple, sensitive and universal genetic detection method includes the following steps:

[0053] In the first step, the DNA probe sequence is designed according to the target gene sequence to be tested, and the HIV-1 DNA (sequence is 5'- AGAAGATATTTGGAATAACATGACCTGGATGCA -3') as the target gene to be tested, design a probe (sequence is 5'-TGGTTTTA TGCATCCAGGTCATGTTATTCCAAATATCTTCT -3'), while using a completely mismatched DNA (sequence 5'-CTAGCTGCATCCCGACGATCGAAGAGTCTGATC-3') as a control, where the bold letters in the probe are the stem structure, which contains T-T base pairs, and the underlined part is the probe and The paired region of the target gene to be tested;

[0054] In the second step, the DNA probe (containing three T-T base pairs) was mixed with mercuric nitrate in a molar ratio of 1:3 at room temperature and allowed to stand for 10 minutes, so that the T-T base pairs and diva...

Embodiment 3

[0060] Example 3: A Simple, Sensitive and Universal Gene Detection Method

[0061] A simple, sensitive and universal genetic detection method includes the following steps:

[0062] In the first step, the DNA probe sequence is designed according to the target gene sequence to be tested, and P53exon8DNA (sequence is 5'-CCTCTGTGCGC CGGTCTCTCCCAGGACAGGCA -3') As the target gene to be tested, design a DNA probe (sequence is 5'- TGCCTGTCCTGGGAGAGACCG TCTGGCT-3'), and R282W p53exon8DNA containing a single mutant base (the sequence is 5'-CCTCTGTGCGC CAGTCTCTCCCAGGACAGGCA -3') as a control, where the bold letter in the probe sequence is the stem structure, which contains T-T base pairs, the underlined part is the pairing region between the probe sequence and the target gene to be tested, and the letter A in bold and italics is a single mutation base;

[0063] In the second step, the DNA probe (containing three T-T base pairs) and mercury hypochlorite were mixed in a molar ratio o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a simple, convenient, sensitive and general gene detecting method. According to the method, a target gene is detected by utilizing fluorescence signals produced through quantum dot doping; the concentration of the to-be-detected target gene and the mutation of single base in the target gene are detected through the fluorescence intensity. The method comprises the following steps of design of a deoxyribonucleic acid (DNA) probe, combination of the probe and metal ions, hybridization of the probe combined with the metal ions and the to-be-detected target gene, release of the metal ions, ion exchange reaction of quantum dot and the metal ions in the solution, obtaining of doped quantum dot, production of the specific fluorescence signals and detection. Compared with a traditional fluorescence probe detection method, the method has the advantages that the probe does not need any chemical labeling or modification and the whole process is only needed to be operated at room temperature; the method is high in detection sensitivity and the limit of detection can be up to the level of pmol per liter; the method is strong in specificity and the mutation of the single base in the gene can be distinguished; the method is generic and all gene sequences can be detected theoretically.

Description

technical field [0001] The invention relates to the fields of functional nanomaterials and biochemistry, in particular to a simple and sensitive general-purpose gene detection method, which includes the preparation and doping of quantum dots, DNA hybridization, the interaction between DNA and metal ions, and fluorescence analysis method etc. Background technique [0002] Gene has always been a hotspot of research by scientists, and it has extremely important research value in the diagnosis and treatment of diseases, especially in the fields of cancer and genetic diseases. Gene sequence information and content levels have been found to be diagnostic indicators for many diseases. Therefore, gene detection technology, especially the detection technology of genes related to human diseases, is of great significance for the diagnosis of diseases, research on pathogenesis and targeted therapy. Practical genetic detection technology requires not only a sensitive detection limit fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6816C12Q2563/137C12Q2563/107
Inventor 马楠何学文
Owner SUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com