Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vegetable oil body gel containing EGF (Epidermal Growth Factor)

A vegetable oil body and gel technology, applied in the biological field, can solve problems such as inconvenient use

Inactive Publication Date: 2014-04-23
JILIN AGRICULTURAL UNIV +1
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, human epidermal growth factor (EGF) for external use is made into freeze-dried dosage form, which achieves the purpose of prolonging the biological activity, that is, the validity period can be extended, the drug effect can be guaranteed, and it has the characteristics of high safety, non-toxicity, and portability. , when using the freeze-dried dosage form for external use, it is necessary to dilute it first, and then use a cotton ball to moisten it and apply it on the affected area, which is inconvenient to use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vegetable oil body gel containing EGF (Epidermal Growth Factor)
  • Vegetable oil body gel containing EGF (Epidermal Growth Factor)
  • Vegetable oil body gel containing EGF (Epidermal Growth Factor)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 The acquisition of safflower EGF transgenic seeds

[0037] According to the Chinese patent ZL 200610171662.0, the announcement number CN100575488C, and the method in Example 2 of the instruction manual, the oil body expression vector p1390ONE was constructed; the nucleotide sequence of human EGF was artificially synthesized according to the codons preferred by plants (as shown in the sequence table SEQ ID NO.1);

[0038] Using the nucleotide sequence of artificially synthesized human EGF as a template, use primers:

[0039] P1: CAAGCTT AATTCAGACTCTGAATGTCC

[0040] P2: GGAATTCTTATTCTCAGTTCCCACCACTTC

[0041] For amplification, the PCR product EGF was digested by HindⅢ and EcoRI and ligated to pUC19 to obtain pUC-EGF. use KpnⅠ and SpeI Double digestion plasmid pUC- EGF and the oil body expression vector p1390ONE, the nucleotide sequence of artificially synthesized human EGF was connected to the oil body expression vector p1390ONE; the recombinant plas...

Embodiment 2

[0042] Example 2 Extraction of safflower oil body

[0043] Take 30g of safflower seeds, wash 3 times with sterilized pure water in a sterile environment, add 5 times the volume

[0044] Buffer I (0.1M Tris-KOH pH7.0, 10mM KCl, 1mM MgCl 2 , 1mM EDTA, O.6M sucrose) were crushed and homogenized, filtered through three layers of gauze, and centrifuged at 6000g 4°C for 20 minutes;

[0045] The solid material in the upper layer was resuspended with buffer I containing 0.6M sucrose, slowly added an equal volume of buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once;

[0046] The solid matter in the upper layer was resuspended with buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once.

[0047] The solid matter in the upper layer was fully resuspended with sucrose-free buffer I, centrifuged at 15000g, 4°C for 20 minutes, and repeated twice. The obtained upper flake is the oil body, which is set as...

Embodiment 3

[0048] Example 3 Determination of the activity of oil bodies containing EGF safflower

[0049] The NIH 3T3 cell line was fully cultured at 37°C, 5% CO 2 Cultured, the cells are in the logarithmic growth phase, and used for the determination of biological activity. Digest and collect the cells, make 5.0×10 with complete culture medium 4 -1.0×10 5 cells / mL cell suspension, seeded in 96-well cell culture plate, 100 μL per well, 37°C, 5% CO 2 Culture, change the maintenance medium (0.3-1% serum) after 24 hours, change the medium, 37°C, 5% CO 2 Incubate for 24 hours. Discard the maintenance solution on the prepared cell culture plate, add the test solution, 100 μL per well, 37°C, 5% CO 2 Incubate for 48 hours, 20 μL MTT solution per well, 37°C, 5% CO 2Incubate for 4-6 hours. After discarding the liquid in the plate, add 100 μL of DMSO to the well, mix well, put it into a microplate reader, measure the absorbance at 570 nm with 630 nm as the reference wavelength, and record...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a vegetable oil body gel containing EGF (Epidermal Growth Factor). The vegetable oil body gel is obtained by mixing a vegetable oil body containing the EGF and a gel matrix of the oil body, wherein the gel matrix of the oil body is composed of 1%-5% of carboxyethyl cellulose, 5%-40% of glycerol, 0.01%-0.1% of methyl paraben, 0.01%-0.1% of propyl paraben, and water injection added to 100%. The vegetable oil body containing the EGF is obtained through the steps of connecting the nucleotide sequence of human EGF to the terminal 3' of the oil body protein nucleotide sequence of the oil body expression vector p1390ONE, transferring to the oil plant so that the EGF is expressed in the oil body, and then extracting the oil body. The prepared vegetable oil body gel is free of mildew and the physicochemical indexes such as appearance and pH of the vegetable oil body gel all are not changed after the vegetable oil body gel is preserved for 12 months at 37 DEG C; even though the vegetable oil body gel is preserved for 12 months at 4 DEG C, the activity of the EGF has no obvious change.

Description

technical field [0001] The invention relates to the field of biological technology, and specifically relates to vegetable oil bodies containing EGF and vegetable oil body gels containing EGF. Background technique [0002] The oil body is composed of a single layer of phospholipid membrane, which contains TAG, and the surface is inlaid with oil body protein, calcium binding protein and sterol binding protein. TAG stored in oil bodies provides energy for seed germination. Oleosins are the major membrane proteins in oil bodies. It is a basic hydrophobin composed of three parts: the lipophilic N-terminus and C-terminus, and the intermediate hydrophobic region. The N-terminus and C-terminus are inlaid on the surface of the oil body and exposed in the cytoplasm. The hydrophobic region in the middle enters the interior of the oil body through the phospholipid membrane. So it creates electrical resistance and electrostatic repulsion, allowing the oil body to exist independently....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/18A61K9/06A61K47/38A61K47/42C12N5/10A61P17/02
Inventor 李海燕李校堃官丽丽杨晶王法微杜林娜金立波姜潮王艳芳王南姚娜董园园刘秀明
Owner JILIN AGRICULTURAL UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More