Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of Hsa-miR-503 in preparation of drug for treating glioma

A technology of hsa-mir-503 and 1.hsa-mir-503 is applied in the application field of preparing medicines for treating glioma, which can solve the problems of shortened course of disease, increased mortality and unsatisfactory curative effect of patients, and achieves increased apoptosis. death, the effect of reducing proliferation

Inactive Publication Date: 2014-01-01
WUHAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the incidence of glioma in my country is increasing year by year, but the curative effect of conventional surgical treatment and radiotherapy and chemotherapy is not satisfactory, and the course of disease is shortened and the mortality rate of patients increases with the increase of pathological grade
In addition, gliomas are not easy to detect early, and the time from the onset of symptoms to seeing a doctor is generally several months or even years.
However, there is no report on the relationship between hsa-miR-503 and the diagnosis and treatment of glioma.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Hsa-miR-503 in preparation of drug for treating glioma
  • Application of Hsa-miR-503 in preparation of drug for treating glioma
  • Application of Hsa-miR-503 in preparation of drug for treating glioma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 qPCR analysis of hsa-miR-503 expression

[0029] (1) Cell lines: U87MG and U251 human malignant glioma cell lines; both cell lines were derived from ATCC.

[0030] Sample preparation: 3 cases of normal brain tissue were obtained from patients with brain contusion in the Department of Brain Surgery, People's Hospital of Wuhan University; 7 cases of malignant glioma were surgical specimens from patients with grade IV glioma after clinical and pathological analysis. provided with the informed consent of the patient. Freeze at -80°C and transport in liquid nitrogen.

[0031] (2) Extraction of total RNA: Trizol reagent was used to extract total RNA from cells and tissues. Trizol reagent was purchased from Invitrogen. The specific steps were as follows:

[0032] 1) Add 1mL Trizol to the cell culture dish, place it on ice for 10min, repeatedly blow and mix with the tip of the pipette, transfer to RNase-free 1.5mL Ep tube; or take 0.1-0.2g fresh tissue in the fume h...

Embodiment 2

[0045] Example 2 Effect of hsa-miR-503 on the proliferation of glioma cells

[0046] The cell proliferation ability was detected by MTT method, and the human glioma cell line U87MG was selected. The control group was transfected with random sequence miR-NC (Negative Control, NC), and the experimental group was transfected with hsa-miR-503 mimics (hsa-miR-503 mimics). Both hsa-miR-503 mimics and random sequences were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (hsa-miR-503 mimics sequence is "UAGCAGCGGGAACAGUUCUGCAG").

[0047] (1) Cell inoculation: U87MG cells in the logarithmic growth phase were made into a single cell suspension with DMEM medium containing 10% (v / v) fetal bovine serum, and inoculated into a 96-well cell culture plate with 6000 cells per well , the volume of each well is 100 μL.

[0048] (2) Cell culture and transfection: after 12 hours, the cells adhered to the wall, transfected with 50nmol hsa-miR-503 mimics or NC, and repeated 6 w...

Embodiment 3

[0053] Example 3 Flow cytometric detection of the effect of hsa-miR-503 on U87MG apoptosis

[0054] (1) 50nmol hsa-miR-503 mimics and NC were transfected in U87MG cells respectively (the transfection method was the same as in Example 2), and the medium was changed after 6 hours.

[0055] (2) After 48 hours of transfection, the cells were digested with trypsin and resuspended with ice-cold PBS (0.01M, pH 7.4). Add 5 μL Annexin V-FITC and 10 μL propidium iodide (PI) respectively, and place on ice Let stand in the dark for 10 minutes.

[0056] (3) Detect apoptosis by flow cytometry and analyze the results.

[0057] The result is as image 3 Shown: Compared with the control group, the apoptosis level of U87MG cells transfected with hsa-miR-503 mimics was significantly increased, indicating that hsa-miR-503 can promote the apoptosis of glioma cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of Hsa-miR-503 (Human Serum Albumin-Micro Ribonucleic Acid-503) in preparation of a drug for treating a glioma. An MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) method, a flow cytometry and a Transwell experiment show that Hsa-miR-503 can effectively reduce proliferation, migration and invasion abilities of glioma cells and increase apoptosis of the glioma cells; qPCR (Quantitative Polymerase Chain Reaction) detection shows that Hsa-miR-503 has low expression in a glioma tissue or a cell line. The results indicate that Hsa-miR-503 can be used for preparing the drug for treating the glioma, and an expression level of Hsa-miR-503 can serve as a diagnostic index of the glioma. The drug for treating the glioma comprises Hsa-miR-503 and / or a precursor of Hsa-miR-503. A detection reagent kit of Hsa-miR-503 comprises a real-time fluorescent quantitation PCR (Polymerase Chain Reaction) reagent, miR-503, as well as a forward primer and a reverse primer of an internal reference. The application provides a new direction for diagnosis and treatment of the glioma.

Description

[0001] technical field [0002] The invention belongs to the technical field of biomedical materials, and specifically relates to the application of hsa-miR-503 in the preparation of drugs for treating glioma. Background technique [0003] Glioma, referred to as glioma for short, is a tumor that occurs in the neuroectoderm. It is the most common intracranial tumor, accounting for about 45%. There are many classification methods for glioma, and astrocytoma is the most common. At present, the incidence of glioma in my country is increasing year by year, but the curative effect of conventional surgical treatment and radiotherapy and chemotherapy is not ideal, and the course of disease is shortened and the mortality rate of patients increases with the increase of pathological grade. In addition, glioma is not easy to detect early, and the time from the onset of symptoms to seeing a doctor is generally several months or even years. [0004] MicroRNA, referred to as miRNA for s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P35/00C12N15/85C12Q1/68
Inventor 刘万红何小华陈雄彭碧文张莹莹
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com