Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression element composed of aspergillus niger and expression vector composed of expression element, and recombined aspergillus niger and construction method and application thereof

A technology for constitutive expression and expression vector, which is applied in the field of genetic engineering research to achieve the effect of saving production costs

Active Publication Date: 2013-12-04
SOUTH CHINA UNIV OF TECH
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no literature report on the construction of expression vectors using the Aspergillus niger Tef promoter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression element composed of aspergillus niger and expression vector composed of expression element, and recombined aspergillus niger and construction method and application thereof
  • Expression element composed of aspergillus niger and expression vector composed of expression element, and recombined aspergillus niger and construction method and application thereof
  • Expression element composed of aspergillus niger and expression vector composed of expression element, and recombined aspergillus niger and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Acquisition of promoter and terminator sequences of transcription elongation factor gene of Aspergillus niger

[0030] Inoculate Aspergillus niger (purchased from the Microbial Strain Collection Center of Guangdong Institute of Microbiology) on PDA solid medium and culture at 28°C until the spores mature. Take an appropriate amount of spores to prepare a suspension and inoculate it in liquid PDA. Cultured at 28°C and 200rpm for 3 days, and the mycelium was harvested for extraction of A. niger genomic DNA.

[0031] Aspergillus niger genome was extracted by benzyl chloride method: mix the mycelia with SDS and benzyl chloride, heat at 50°C, then add 3M sodium acetate solution and mix well, bathe in ice water for 15 minutes, centrifuge for 15 minutes, take the supernatant, add an equal volume Precipitate with isopropanol at room temperature for 20 min. After high-speed centrifugation at room temperature for 15 minutes, the precipitate was washed once with 70% ethanol, drie...

Embodiment 2

[0037] Acquisition of the promoter and terminator sequences of pyruvate kinase gene from Aspergillus niger

[0038] According to the Aspergillus niger pyruvate kinase gene information published by Genbank (accession number: S38698), primers were designed to amplify its promoter and transcription termination sequence. The promoter element sequence of Aspergillus niger pyruvate kinase gene is shown in SEQ ID NO.7. The subelement sequence is shown in SEQ ID NO.8. The primer sequences are as follows:

[0039] Table 2 Primer Information List

[0040]

[0041] Using Takara's PrimeSTAR high-fidelity DNA polymerase, the extracted Aspergillus niger genome was used as a template, and amplified according to the conditions of the polymerase instructions. The size of the PCR product was detected by agarose nucleic acid electrophoresis and verified by sequencing.

Embodiment 3

[0043] Construction of Aspergillus niger constitutive expression vector

[0044] Design specific amplification primers according to the Amds gene sequence, the sequence is as follows: Amds-F:

[0045] GGGGTACCTTTTGAATAGCTCGCCCGCT (KpnI); Amds-R:

[0046] CCGCTCGAGCTAGACTGGAAACGCAACCC (XhoI), using Amds-F and Amds-R, and using the commercial pKLAC1 vector containing Amds gene (New England Biolabs, USA) to amplify the Amds gene fragment, the Amds gene sequence is shown in SEQ ID NO.9. The Amds gene fragment was digested with KpnI and XhoI, and cloned into the commercial vector pbluscript (Stratagene, USA) to obtain an intermediate vector pbluscript-Amds. In order to obtain the expression vector containing the transcription elongation factor gene expression element, its promoter gene fragment P tef 1490、P tef 990.P tef 690 and P tef 390 were digested with XhoI and HindIII respectively, and cloned into the intermediate vector pbluescript-Amds to obtain pbluescript-P tef 1490...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression element composed of an aspergillus niger and an expression vector composed of the expression element, and a recombined aspergillus niger and a construction method and an application thereof. The expression element is prepared from an aspergillus niger transcription elongation factor gene promoter and an aspergillus niger transcription elongation factor gene terminator, wherein the aspergillus niger transcription elongation factor gene promoter is composed of 1490, 990 or 690 basic groups of which sequence is as shown in SEQID NO.1, SEQID NO.2 and SEQID NO.3; the aspergillus niger transcription elongation factor gene terminator is composed of 1022 basic groups of which sequence is as shown in SEQID NO.5. The expression element can start protein expression without adding an inductor, so that the production cost is saved; the expression element can be used for preparation of pharmaceutical protein of eukaryotes and microbial sources and enzymes for industrial purposes.

Description

technical field [0001] The invention belongs to the field of genetic engineering research, and in particular relates to a constitutive expression vector of Aspergillus niger and its application. Background technique [0002] Filamentous fungi have strong protein secretion ability, and the total extracellular protein secreted by some filamentous fungi can reach 40g / L. This high-efficiency protein secretion ability is unmatched by prokaryotic expression hosts such as bacteria. Filamentous fungi also have various gene post-translational processing capabilities, such as glycosylation modification, signal peptide cleavage and disulfide bond formation. Filamentous fungi such as Aspergillus oryzae, Aspergillus niger and Trichoderma reesei are all food-safe strains and have been identified as GRAS (Generally recognized as safe) strains by the US Food and Drug Administration. In the production of industrial enzymes, the fermentation of filamentous fungi occupies the core position. N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/80C12N15/66C12N1/15C12N9/20C12R1/685
Inventor 王永华蓝东明王卫飞杨博
Owner SOUTH CHINA UNIV OF TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More