Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dual gene for improving crop yield as well as encoding protein and application thereof

A dual gene, gene technology, applied in the direction of plant gene improvement, application, plant products, etc., to achieve the effect of improving enzyme activity, improving plant yield, and growing and developing

Inactive Publication Date: 2013-09-25
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After searching, no report was found on the simultaneous transfer of two genes into plants to improve plant yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual gene for improving crop yield as well as encoding protein and application thereof
  • Dual gene for improving crop yield as well as encoding protein and application thereof
  • Dual gene for improving crop yield as well as encoding protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1, the acquisition of rapeseed cy-fbpase gene fragment

[0052] Proceed as follows:

[0053] (1) Cloning of the cy-fbpase gene: Firstly, by comparing the known homologous sequences of the cy-fbpase gene, the conserved sequence of the gene was found, and primers were designed. Conserved sequence amplification primers are as follows:

[0054] F-1 GTTGTTTTTGATCCACTTGATGG (Seq ID No: 7)

[0055] R-1 GGCTTGCTCCATCAAGAACG (Seq ID No: 8)

[0056] Using rapeseed genomic DNA as template and F-1 and R-1 as primers (primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.) for PCR amplification, the reaction system is as follows: 10×Taq DNA Polymerase Buffer 5μL, dNTP Mix (10mM) 2 μL, F-1 (10 μM) 1 μL, R-1 (10 μM) 1 μL, genomic DNA (50 ng / μL) 1 μL, Taq DNA polymerase (Taq DNA polymerase was purchased from TaKaRa Company, the same below) 0.5 μL, ddH 2 O39.5 μL, a total of 50 μL. PCR reaction conditions: 94°C for 5min; 94°C for 30s, 56°C for 30s, 72°C for...

Embodiment 2

[0062] The construction of embodiment 2, cy-fbpase gene expression vector

[0063] Proceed as follows:

[0064] (1) In order to avoid the restriction site contained in the target gene being cut during the vector construction process, the cDNA sequence of the rapeseed cy-fbpase gene was analyzed by the software Vector NT1, and the 173bp site of the rapeseed cy-fbpase gene was divided by G changed to A, changed from G to G at the 258th position, and changed from A to G at the 374th position. Although the codon changed, the encoded amino acid did not change. These three point mutations were obtained by using rapeseed cDNA as the substrate , performing site-directed mutagenesis by stacking extension PCR method, the sequence obtained after site-directed mutagenesis is shown in SEQ ID No: 4 (the gene is still referred to as cy-fbpase hereinafter).

[0065] (2) Construction of the intermediate vector: Use PstI and XhoI (restriction endonucleases were purchased from Fermentas, the sa...

Embodiment 3

[0067] The cloning of embodiment 3, SBPase gene fragment

[0068] (1) The conserved sequence of the SBPase gene: The primer pair for PCR amplification of the SBPase gene was designed according to the conserved sequence of the SBPase gene. F and SBP-R were used as primers for PCR amplification, and the conserved sequences and degenerate primer sequences were as follows:

[0069] SBP-F GGGAATTCGATGTGYATGGGAGAAGCWTTG (SEQ ID No: 11)

[0070] SBP-RGGAAGCTTGGMACCATTCCTCCRGTGTATC (SEQ ID No: 12)

[0071] Reaction system for PCR amplification of conserved sequences (50 μL): 5 μL of 10X Taq DNA polymerase buffer, 2 μL of dNTP Mix (10 mM), 1 μL of SBP-F (10 μM), 1 μL of SBP-R (10 μM), 1 μL of rapeseed genomic DNA, Taq DNA polymerase 0.5 μL, ddH 2 O39.5 μL. PCR reaction program: 94°C for 5min; 30 cycles of 94°C for 30s, 63°C for 30s, 72°C for 1min; 72°C for 8min. Electrophoresis detection: Prepare 1% agarose gel, electrophoresis at 100V voltage for 30-40min, observe by gel imaging, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dual gene for improving crop yield and belongs to the field of plant genetic engineering. The dual gene disclosed by the invention comprises a gene A and a gene B, wherein the gene A is formed by a nucleotide sequence represented by SEQID No: 1; the gene B is formed by a nucleotide sequence represented by SEQID No: 2; the gene A is a rapeseed cytoplasmic fructose-1,6-biphosphatase gene; and the gene B is a rapeseed sedoheptulose-1,7-biphosphatase gene. The invention further discloses an expression vector and the like of the dual gene. According to the dual gene, the overexpressions of the two genes have obvious promotion effects on the growth and the development of plants; a dual-gene-transformed plant is high in gene expression and enzymatic activity; and an effective method is provided for improving the crop yield.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. In particular, it relates to digenes for increasing crop yields, encoded proteins of the digenes, and their application in increasing crop yields. Background technique [0002] Cultivating high-yielding and stress-resistant crop varieties has always been the goal of human agricultural production. As the environment continues to deteriorate, extreme weather increases, and the impact of climate on agriculture increases. Agriculture is facing the severe test of frequent natural disasters. Coupled with the ever-increasing world population and the gradual emergence of the food crisis, it is particularly urgent to cultivate new varieties of crops with high yield and strong stress resistance. [0003] Mason and Maskill (1928) proposed the concept of source (sink) in photosynthetic production, which was later developed by Evans et al. The "source" of plants refers to the ability of plants to per...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N15/63A01H5/00C12N15/82C12Q1/68C12N15/11
Inventor 张锐郭三堆郭利娜
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More