Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HCMV pp65 prokaryotically-expressed recombinant strain and construction method thereof

A technology of recombinant protein and expression plasmid, which is applied in the field of genetic engineering, can solve the problems of long culture period and low expression level, and achieve good antigenicity

Inactive Publication Date: 2013-09-04
HUNAN NORMAL UNIVERSITY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Domestic researchers have used Pichia pastoris to express pp65 recombinantly [12] , but the expression level is not high, and the culture period is relatively long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HCMV pp65 prokaryotically-expressed recombinant strain and construction method thereof
  • HCMV pp65 prokaryotically-expressed recombinant strain and construction method thereof
  • HCMV pp65 prokaryotically-expressed recombinant strain and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Isolation and cultivation of human cytomegalovirus

[0049] Human embryonic lung fibroblasts (HEL) were subcultured with DMEM medium containing 10% fetal bovine serum, and cultured in a 10 mm cell culture dish. After the cells grew to 40%-50% of the surface area of ​​the bottom of the dish, HCMV AD169 strain to infect HEL cells, the preserved virus solution was added dropwise to the culture dish on which HEL was grown, the infection amount was 1000 pfu / dish, and placed in 5% CO 2 After incubating in a cell incubator at 37°C for 1 hour, replace it with 2% calf serum in DMEM cell culture medium. After infection and culture for 5-7 days, the cell supernatant containing HCMV was collected after the cells were basically lesioned.

[0050] Human fibroblasts (HEL) were elongated fibrous cells before virus infection ( figure 1 A), after 3 days of HCMV infection, the cells were observed under the microscope to have obvious lesions, the cells were enlarged, and inclu...

Embodiment 2

[0052] Cloning of embodiment two HCMV pp65 gene

[0053] HCMV DNA was extracted using the QIAamp DNA Stool Mini Kit. Using Oligo 6.0 software, design primers according to the HCMV UL83 gene sequence, (introduced in the upstream primer Nde I site, FP 5′- CATATG ATATCCGTACTGGGTCCC-3'; downstream primer introduction Bam H I site, RP: 5′- GGATCC CAGATTCTGACCCTGAACCG -3′), and then use HCMV DNA as template to amplify pp65 gene, the reaction system is: 10×PCR Buffer 10 μL, dNTPs (10 mmol / L) 4 μL, upstream and downstream primers (10 μmol / L) 4 μL each, Taq DNA polymerase (5 U / μL) 1 μL, DNA 8 μL, deionized water to make up to 100 μL. PCR reaction conditions: 94°C for 5 min; 94°C for 40 sec, 63°C for 40 sec; 72°C for 1 min and 30 sec, 29 cycles; 72°C for 10 min. The PCR product was identified by 1% agarose gel electrophoresis, the PCR product was recovered from the gel and connected to the pMD18-T vector, and transformed E. coli Top10F`competent cells, the recombinant p...

Embodiment 3

[0056] Example 3 Induced expression of target protein

[0057] Pick the screened strains and inoculate them into 5 mL LB liquid medium (containing 100 μg / mL kanamycin sulfate (Kan + ) at 37°C to OD 600 When the value reached 0.6, IPTG with a final concentration of 0.4 mmol / L was added to induce expression. At the same time, the strain transformed with the recombinant expression plasmid was not induced as a negative control, and other culture conditions were consistent with the experimental group. After induction at 37°C for 4 h, the cells were collected by centrifugation at 12,000 g for 10 sec at room temperature. Protein samples were prepared, and the expression of recombinant protein was analyzed by 10% SDS-PAGE.

[0058] The induced recombinant strains and control strains were prepared as protein samples for SDS-PAGE. As a result, there were differences between the test group of the recombinant strains induced by IPTG and the control group without IPTG induction. The indu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses HCMV pp65 gene fragment-containing engineering bacteria. An expressed recombinant pp65 protein secreted by the HCMV pp65 gene fragment-containing engineering bacteria can be used as an antigen, has good reactogenicity, can be used for preparation of corresponding antigen-diagnosis monoclonal antibodies for animal immunization, and provides a basis for development of an ELISA rapid diagnosis antibody kit. The recombinant antigen can be used as an excellent material for preparation of a pp65 subunit vaccine.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to the expression of viral proteins. Background technique [0002] Human cytomegalovirus (HCMV) is a double-stranded DNA virus with a nucleic acid size of about 235kb, a diameter of about 200nm, and a capsid composed of 162 capsomers with an outer envelope. It is also the largest of the herpes viruses. HCMV infection is very common. In my country, the infection rate of the adult population can reach 60% to 100%. [1] , and in developed countries, the population infection rate is as high as 40% to 60%. Usually, it is latent infection in healthy people without obvious clinical symptoms, but in individuals with low immune function such as organ transplantation, AIDS, malignant tumors, etc. In patients, HCMV can cause serious infections. Studies have shown that active HCMV infection is the leading cause of organ transplant failure and AIDS death [2,3] . At the same tim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C07K14/045G01N33/68G01N33/577C12R1/19
Inventor 刘如石许凤邱义兰邱果李桑何赛郑姣黄雄军
Owner HUNAN NORMAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More