HCMV pp65 prokaryotically-expressed recombinant strain and construction method thereof
A technology of recombinant protein and expression plasmid, which is applied in the field of genetic engineering, can solve the problems of long culture period and low expression level, and achieve good antigenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Isolation and cultivation of human cytomegalovirus
[0049] Human embryonic lung fibroblasts (HEL) were subcultured with DMEM medium containing 10% fetal bovine serum, and cultured in a 10 mm cell culture dish. After the cells grew to 40%-50% of the surface area of the bottom of the dish, HCMV AD169 strain to infect HEL cells, the preserved virus solution was added dropwise to the culture dish on which HEL was grown, the infection amount was 1000 pfu / dish, and placed in 5% CO 2 After incubating in a cell incubator at 37°C for 1 hour, replace it with 2% calf serum in DMEM cell culture medium. After infection and culture for 5-7 days, the cell supernatant containing HCMV was collected after the cells were basically lesioned.
[0050] Human fibroblasts (HEL) were elongated fibrous cells before virus infection ( figure 1 A), after 3 days of HCMV infection, the cells were observed under the microscope to have obvious lesions, the cells were enlarged, and inclu...
Embodiment 2
[0052] Cloning of embodiment two HCMV pp65 gene
[0053] HCMV DNA was extracted using the QIAamp DNA Stool Mini Kit. Using Oligo 6.0 software, design primers according to the HCMV UL83 gene sequence, (introduced in the upstream primer Nde I site, FP 5′- CATATG ATATCCGTACTGGGTCCC-3'; downstream primer introduction Bam H I site, RP: 5′- GGATCC CAGATTCTGACCCTGAACCG -3′), and then use HCMV DNA as template to amplify pp65 gene, the reaction system is: 10×PCR Buffer 10 μL, dNTPs (10 mmol / L) 4 μL, upstream and downstream primers (10 μmol / L) 4 μL each, Taq DNA polymerase (5 U / μL) 1 μL, DNA 8 μL, deionized water to make up to 100 μL. PCR reaction conditions: 94°C for 5 min; 94°C for 40 sec, 63°C for 40 sec; 72°C for 1 min and 30 sec, 29 cycles; 72°C for 10 min. The PCR product was identified by 1% agarose gel electrophoresis, the PCR product was recovered from the gel and connected to the pMD18-T vector, and transformed E. coli Top10F`competent cells, the recombinant p...
Embodiment 3
[0056] Example 3 Induced expression of target protein
[0057] Pick the screened strains and inoculate them into 5 mL LB liquid medium (containing 100 μg / mL kanamycin sulfate (Kan + ) at 37°C to OD 600 When the value reached 0.6, IPTG with a final concentration of 0.4 mmol / L was added to induce expression. At the same time, the strain transformed with the recombinant expression plasmid was not induced as a negative control, and other culture conditions were consistent with the experimental group. After induction at 37°C for 4 h, the cells were collected by centrifugation at 12,000 g for 10 sec at room temperature. Protein samples were prepared, and the expression of recombinant protein was analyzed by 10% SDS-PAGE.
[0058] The induced recombinant strains and control strains were prepared as protein samples for SDS-PAGE. As a result, there were differences between the test group of the recombinant strains induced by IPTG and the control group without IPTG induction. The indu...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap