Supercharge Your Innovation With Domain-Expert AI Agents!

Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection

A liquid-phase chip and amplification primer technology, which is applied in biochemical equipment and methods, DNA/RNA fragments, and microorganism determination/inspection, etc. low price effect

Inactive Publication Date: 2013-04-17
SHANGHAI CHEST HOSPITAL +1
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

DNA sequencing is currently the gold standard for detecting EGFR gene mutations by comparing forward and reverse bidirectional sequencing. However, this method requires amplification, purification, and sequence analysis of sequencing samples. There are many steps, and the reaction takes a long time, which may increase the probability of errors.
In addition, the DNA sequencing method also has many disadvantages such as cumbersome operation, complex interpretation of results, and high requirements for the environment and operators. Therefore, it is only suitable for a few well-equipped laboratories, and few hospitals at all levels can carry out it independently.
Although the real-time fluorescence quantitative PCR method can detect more samples in a short period of time, each reaction can only detect one or a few mutations, which cannot achieve high throughput, and there is also the possibility of false negatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection
  • Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection
  • Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The liquid phase chip of embodiment 1 EGFR gene mutation detection, it comprises:

[0032] 1. PCR amplification primers

[0033] The mutations related to the efficacy of tyrosine kinase inhibitor (TKI) drugs are mainly located in exons 18, 19, 20 and 21 of the EGFR gene, and primers for the target sequences were designed for the relevant regions, as shown in Table 2:

[0034] Table 2 PCR amplification primer sequence

[0035] Types of

Primer sequence (5'→3')

Exon 18 upstream primer

CCATGCACAACTTCCCTACC(P18U)

Exon 18 downstream primer

ACAGCTTGCAAGGACTCTGG(P18L)

Exon 19 upstream primer

CCCCAGCAATATCAGCCTTA(P19U)

Exon 19 downstream primer

AGTGCTGGGTAGATGCCAGT (P19L)

Exon 20 upstream primer

CTCTCCCACTGCATCTGTCA(P20U)

Exon 20 downstream primers

CATATCCCCATGGCAAACTC (P20L)

Exon 21 upstream primer

CCTCACACAGCAGGGTCTTCTC(P21U)

Exon 21 downstream primer

ATCCTGCAGGGAGAGACTGA (P21...

Embodiment 3

[0079] The performance evaluation of the liquid phase chip is carried out using the sample detection method of Example 2

[0080] The source of the mutant reference product: The upstream and downstream sequences of the reference mutant gene locus are entrusted to Shanghai Sangon Bioengineering Technology Service Co., Ltd. to synthesize them by gene fragment synthesis and insert them into engineering plasmid vectors.

[0081] The source of the wild-type genome: It was prepared by extracting anticoagulated blood from healthy people using a commercially available genome purification kit, and it was sequenced to verify that there were no mutations at the relevant mutation sites.

[0082] The main performance indicators are as follows:

[0083] Sensitivity: The wild-type normal human genome (mutated gene: wild-type human genome = 2000:10000 (copies)) is mixed with 8 kinds of mutant-type reference products as the detection sample, and the liquid-phase chip is as low as 10% in the ba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technology of medical IVD (in vitro diagnosis) and particularly relates to an amplification primer, a detection probe and a liquid phase chip for EGFR (epidermal growth factor receptor) gene mutation detection. The liquid phase chip for EGFR gene mutation detection comprises PCR (polymerase chain reaction) amplification primers, LDR (ligase detection reaction) connection probes and Anti-Tag sequence coated microspheres, wherein the amplification probes comprise four pairs of primers for exons 18, 19, 20 and 21; and the connection probes comprise eight pairs of connection probes for eight primary mutation sites related with drug therapeutic effect of a tyrosine kinase inhibitor (TKI). The liquid phase chip can be used for carrying out joint detection on mutation of eight EGFR genes and accurately analyzing the eight mutation sites at the same time by single reaction, and has the characteristics of low price and suitability for parallel detection of a large amount of samples.

Description

technical field [0001] The invention belongs to medical in vitro diagnostic technology, and specifically relates to an amplification primer, a detection probe and a liquid phase chip for detecting mutations on the EGFR gene related to the curative effect of tyrosine kinase inhibitor (TKI) drugs. Background technique [0002] Epidermal growth factor receptor (EGFR) is a member of the cell surface receptor tyrosine kinase HER / ErbB family, which can specifically bind to ligands and make itself Phosphorylation, thereby regulating cell growth or survival. [0003] Molecular targeted therapy targeting EGFR is becoming increasingly prominent in the treatment of NSCLC, among which EGFR tyrosine kinase inhibitors (TKI), such as gefitinib and erlotinib, are the most important. Pre-clinical trials of NSCLC have shown that after failure of platinum-based drugs combined with chemotherapy, gefitinib still has an objective response rate of 12% to 18%, a disease control rate of >40%, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 娄加陶周妍王勤熙
Owner SHANGHAI CHEST HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More