Amplification primer, detection probe and liquid phase chip for EGFR gene mutation detection
A liquid-phase chip and amplification primer technology, which is applied in biochemical equipment and methods, DNA/RNA fragments, and microorganism determination/inspection, etc. low price effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] The liquid phase chip of embodiment 1 EGFR gene mutation detection, it comprises:
[0032] 1. PCR amplification primers
[0033] The mutations related to the efficacy of tyrosine kinase inhibitor (TKI) drugs are mainly located in exons 18, 19, 20 and 21 of the EGFR gene, and primers for the target sequences were designed for the relevant regions, as shown in Table 2:
[0034] Table 2 PCR amplification primer sequence
[0035] Types of
Primer sequence (5'→3')
Exon 18 upstream primer
CCATGCACAACTTCCCTACC(P18U)
Exon 18 downstream primer
ACAGCTTGCAAGGACTCTGG(P18L)
Exon 19 upstream primer
CCCCAGCAATATCAGCCTTA(P19U)
Exon 19 downstream primer
AGTGCTGGGTAGATGCCAGT (P19L)
Exon 20 upstream primer
CTCTCCCACTGCATCTGTCA(P20U)
Exon 20 downstream primers
CATATCCCCATGGCAAACTC (P20L)
Exon 21 upstream primer
CCTCACACAGCAGGGTCTTCTC(P21U)
Exon 21 downstream primer
ATCCTGCAGGGAGAGACTGA (P21...
Embodiment 3
[0079] The performance evaluation of the liquid phase chip is carried out using the sample detection method of Example 2
[0080] The source of the mutant reference product: The upstream and downstream sequences of the reference mutant gene locus are entrusted to Shanghai Sangon Bioengineering Technology Service Co., Ltd. to synthesize them by gene fragment synthesis and insert them into engineering plasmid vectors.
[0081] The source of the wild-type genome: It was prepared by extracting anticoagulated blood from healthy people using a commercially available genome purification kit, and it was sequenced to verify that there were no mutations at the relevant mutation sites.
[0082] The main performance indicators are as follows:
[0083] Sensitivity: The wild-type normal human genome (mutated gene: wild-type human genome = 2000:10000 (copies)) is mixed with 8 kinds of mutant-type reference products as the detection sample, and the liquid-phase chip is as low as 10% in the ba...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com