Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of prion protein antibody and its preparation method and application

A prion protein and antibody technology, applied in the field of prion protein antibody and its preparation, can solve the problem that the prion protein antibody cannot meet the needs of the detection market and the like

Active Publication Date: 2015-09-30
SHANGHAI TRANSGENIC RES CENT
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection market for prion protein diseases is extremely huge, with various types (various animal meat products, animal meat and bone powder feed, animal and human blood products, and even some cosmetics, etc.). There are at least several million or even tens of millions of test samples, and the prion protein antibody obtained by the existing technology cannot meet the needs of a large number of test markets

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of prion protein antibody and its preparation method and application
  • A kind of prion protein antibody and its preparation method and application
  • A kind of prion protein antibody and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Preparation of prion gene knockout sheep

[0097] The animals used for immunization in this example were obtained from the Shanghai Transgenic Research Center. For the detailed preparation method, see the patent "A Method for Preparing Prion Gene Knockout Livestock", application number: 200510110773.6. The passaged sheep with complete knockout of the prion protein gene were used for subsequent experiments.

Embodiment 2

[0099] Preparation of recombinant prion protein antigen for sheep immunization

[0100] 1. Cloning of sheep Prnp gene

[0101] Referring to GENBANK, the sheep prion protein gene sequence is registered, and its Genbank number is: EU253454.

[0102] According to this sequence, design PCR amplification primer, its sequence is as follows:

[0103] SEQ ID NO: 1CCCAAGCTTAAGAAGCGACCAAAAACCTGG;

[0104] SEQ ID NO: 2 CCGCTCGAGACTTGCCCCCCTTTGGTAAT.

[0105] Amplify the mature mRNA sequence of sheep PRNP (remove the N-terminal and C-terminal signal peptides), and introduce restriction sites at both ends. Since the coding region of the sheep PRNP gene is a single-exon gene, sheep genomic DNA is used as a template. KOD-Plus high-fidelity enzyme was used for amplification, and the reaction system is shown in Table 1.

[0106] Table 1

[0107] components

add volume

10×PCR buffer

2μl

dNTP mix

2μl

25mmol / L Mg2+

1.5μl

20μmol / L upstream a...

Embodiment 3

[0121] Preparation and Characteristic Analysis of Recombinant Sheep Prion Protein Polyclonal Antibody

[0122] The purified recombinant protein was immunoidentified by using Western-blot method, using prion protein monoclonal antibody SAF32 (SPI-bio) as the primary antibody, and horseradish peroxidase-labeled goat anti-mouse polyclonal antibody as the secondary antibody. resistance, see the result Figure 4 , it can be seen that the purified protein can specifically bind to the prion protein monoclonal antibody.

[0123] 1. Immunity

[0124] The recombinant prion protein prepared and purified in Example 2 was used as the immunogen, injected subcutaneously at 4-5 points on the back of the transgenic sheep for immunization, 4 consecutive immunizations with 15 days interval between each time, before immunization and 7 days after each immunization , Collect jugular vein blood, collect 20ml serum, and measure its ELISA titer.

[0125] For the first immunization, fully emulsify t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a prion protein antibody as well as a preparation method and an application thereof. Specifically, the antibody has the following characteristics that (a) the antibody is derived from an animal which does not express prion protein, and is specifically targeted with the the prion protein of the animal; and (b) the combining titer of the antibody and the prion protein of the animal is greater than 10000, wherein the animal is a domestic animal. Furthermore, the invention provides a method for preparing the antibody and an application of the antibody.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a prion protein antibody and its preparation method and application. Background technique [0002] Prion-related diseases (also known as Prion diseases) are a group of chronic degenerative diseases of the central nervous system that are sporadic, familial and disseminated, and are new infectious diseases that are common to humans and animals. The main features of the disease are massive death of central nervous cells, vacuolation of the brain and concomitant astrogliosis, etc. These lesions lead to movement disorders, dementia, and eventually death of affected animals. [0003] At present, there are many kinds of Prion diseases in animals, in addition to sheep scrapie (Scrapie), it also includes transmissible mink encephalopathy (TME), deer chronic wasting disease (CWD), bovine spongiform encephalopathy (BSE) and cat spongiform encephalopathy (FSE); human Prion diseases include Creu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/18C07K16/06G01N33/68G01N33/569
Inventor 成国祥俞慧清陈建泉王学斌
Owner SHANGHAI TRANSGENIC RES CENT
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More