Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Insulin bio-sensitizer and application thereof

An insulin and sensitizer technology, applied in the field of insulin biosensitizers, drugs, and peptides that increase insulin sensitivity, can solve problems such as aggravating insulin resistance, aggravating diabetes and its complications, and achieve regulation of lipid metabolism. Effects of disorders, blood pressure lowering vascular endothelial function, and delaying the time of complications

Inactive Publication Date: 2014-04-30
MAANSHAN GUOSHENG BIO TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although DPP-4 incretins lead the change in the concept of type 2 diabetes treatment, insulin resistance is not resolved in type 2 diabetes, and the efforts to promote insulin secretion and increase the concentration of insulin in the blood are futile and difficult to achieve the expected results , instead these measures will exacerbate insulin resistance and ultimately diabetes and its complications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insulin bio-sensitizer and application thereof
  • Insulin bio-sensitizer and application thereof
  • Insulin bio-sensitizer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Expression of Trypsin Fusion Protein

[0052] 1) Construction of hGH-InBP-polyG-IgG4Fc integration plasmid

[0053] Mammalian expression system of fusion protein expressed by fusion of human growth hormone secretory peptide-insulin high-affinity binding sequence-glycine-rich sequence (PolyG)-Fc fragment of human immunoglobulin 4.

[0054] First, the forward chain hGH-F and reverse co-adjuvant chain hGH-R of human growth hormone secretory peptide were synthesized in vitro.

[0055] hGH-F:

[0056] GCGGAATTCACCATGCCACTCTGGGTGTTCTTCTTTGTGATCCTCACCCTCAGCAACAGCTCCCACTGCTCCACCGGT.

[0057] hGH-R:

[0058] ACCGGTGGAGCAGTGGGAGCTGTTGCTGAGGGTGAGGATCACAAAGAAGAACACCCAGAGTGGCATGGTGAATTCCGC.

[0059] Secondly, the forward chain InBP-F and the reverse complementary chain InBP-R of the insulin high-affinity binding sequence were designed. The two pairs of repeated oligonucleotides were annealed and phosphorylated in vitro, and polyG three fragments were ligated into ...

Embodiment 2

[0071] Example 2 Establishment of Trysin Stable Expression Cell Line

[0072] In order to obtain a cell line stably expressing trypsin (InSA) fusion protein, in this example, the constructed integration plasmid p208-InSA was firstly transfected into CHO-K1 cells (purchased from ATCC). Mammalian cells CHO-K1 cells in 35 mm cell culture plates in complete medium (DMEM) at 37 °C and 5% CO 2 Incubate overnight. Using Lipofectamine 2000 (purchased from Invitrogen) transfection reagent, p208-InSA plasmid DNA was transfected into CHO-K1 cells. 24 hours after transfection, cells were transferred to 100 mm culture plates and cultured for another 24 hours. Then, the medium was replaced with G418 (1000 μg / mL) selection medium. After the cells in the control group had no viable cells, they were replaced with low G418 (100 μg / mL) medium. Cell clones were carefully picked after maintaining the culture for 2-4 weeks. After the cells were cultured in the 12-well plate for 4 weeks, 1 μL...

Embodiment 3

[0073] Example 3 Amplified preparation method of trypsin fusion protein

[0074] The screened stable and high-expression cell lines continued to be scaled up until they were placed in 10 cm culture dishes. Store in liquid nitrogen and -80°C separately, and then scale up the culture until the 10cm culture dish is 100% confluent. Then, divide the cells so that 1 x 10 6 / mL density into a 250 mL roller bottle culture flask at 37°C, 5% CO 2 , cultivated at 120 rpm. When the cell density reaches 6×10 6 After / mL, the cells were transferred to 1L roller bottle culture flasks, and cultured under the same conditions until the cells no longer grew significantly (about a week). The cell suspension was centrifuged at low temperature, and the cell culture supernatant was retained for identification by SDS-PAGE and Western blot analysis. At the same time, the cell culture supernatant was freeze-dried and stored at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention, belonging to the field of biological pharmacy, relates to an insulin bio-sensitizer and an application thereof, particularly relates to a polypeptide for increasing insulin sensitivity and an application of the polypeptide in preparing medicines for treating insulin resistance. The polypeptide specifically combines insulin and brings extracellular free insulin into somatic cells to let insulin effect to treat diseases or syndromes related to insulin resistance, such as diabetes, obesity, hyperlipidemia, atherosclerosis, hypertension, heart disease, senescence, agedness dementia, cancer, etc, and can be used for preventing and slowing the occurrence and development of diseases or conditions.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and relates to an insulin biosensitizer and an application thereof. Specifically, it is a polypeptide that increases insulin sensitivity, and the application of the polypeptide in the preparation of medicines for treating insulin resistance. The polypeptide can specifically bind insulin, bring extracellular free insulin into body cells, make insulin exert its effect, and treat diseases or syndromes related to insulin resistance. Background technique [0002] Industrialization has steadily improved and enhanced people's living standards by providing plentiful and cheap food and affordable modes of transportation such as automobiles. However, people tend to overeat and be physically inactive, resulting in an imbalance between energy intake and expenditure. Excess energy is converted to excess fat and the result is obesity. Obesity leads to ectopic accumulation of fat in skeletal muscle, adipose...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/85A61K38/17A61P3/04A61P3/10A61P9/00A61P1/16A61P25/28A61P35/00A61P43/00
Inventor 刘辉宇邹敏旭
Owner MAANSHAN GUOSHENG BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com