Yunnan red pear [delta]PybHLH gene and prokaryotic expression vector and application thereof
A prokaryotic expression and gene technology, applied in the field of genetic engineering, can solve problems such as lack of scientific theory, and achieve the effect of strong specificity, efficient purification and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1: the present invention PyBH Genes and their specific fragments ?PybHLH cloning, the specific steps are as follows:
[0040] (1) Primer design
[0041] according to apple MdbHLH33 Gene (GenBank accession number is DQ266451.1) coding frame, design a pair of specific primers PybHLH-F : 5'- GTC GAC ATGGCTCAGAATCATGAGAGGGTG-3' and PybHLH-R :3': CTCGAG GCACTTACCAGCAATTTTCCAAAGC, added at the 5′ end of the upstream and downstream primers respectively Sal I and xho I Restriction site and protective base (the underlined part is the restriction site).
[0042] (2) Extraction of total RNA
[0043] a. After fully grinding the red pericarp of 0.1 g Yunhong pear into powder with liquid nitrogen, add 1 ml RNA extraction buffer (4 M guanidine isothiocyanate, 25 mM sodium citrate, 0.5 % (w / v) 12 Alkyl sarcosinate, 2% (w / v) PVP, β-mercaptoethanol), transferred to a 2 ml centrifuge tube, grinded evenly, and then added 1 / 10 volume of 2 M sodium acetate (pH 4....
Embodiment 2
[0056] Example 2: Prokaryotic expression vector pET32a- ?PybHLH build ( Figure 11 )
[0057] use Nco I and xho I to pMD18T- ?PybHLH and the vector pET32a were digested according to the instructions to obtain the 5' end carrying Nco I and 3' end with xho I's ?PybHLH The fragment and the pET32a vector were gel-recovered after electrophoresis, and the sample was loaded according to the molar ratio of target gene:vector = 3:1, then Ligation Solution I was added, and ligated at 16°C for 16 h. Competent Escherichia coli E. coli DH5α 100 μl was added to 6 μl connection system and mixed; the mixture was ice-bathed for 30 min, heat stimulated at 42 °C for 45 s, and ice-bathed for 2 min; 900 μl liquid medium SOC was added, and the bacteria were recovered by shaking at 37 °C at 200 rpm for 60 min; After the end, centrifuge at 8000 rpm at room temperature for 1 min to collect the bacteria; absorb the supernatant on the ultra-clean bench, and when about 0.1 ml remains, use a pi...
Embodiment 3
[0058] Example 3: ?PybHLH Prokaryotic expression of
[0059] The recombinant plasmid pET32a- ΔPybHLH Transformed into E. coli Rosetta (DE3) Competent cells. Apply LB+Amp solid plate, pick pET32a-Δ PyBH The recombinant colonies were cultured in LB + Amp liquid medium at 37 °C and 200 rpm shaking overnight, and then inoculated on the same LB medium at a ratio of 1:100 and cultivated to OD 600 0.6-0.8, add IPTG to a final concentration of 0.5 mM, culture at 16 °C for 0, 2, 4, 6 and 16 h, and collect the bacterial liquid for total protein analysis. Centrifuge at 12 000 rpm at 4°C for 1 min, discard the supernatant, and use 100 μl of SDS gel loading buffer (Tris-HCl 50 mM, pH 6.8; SDS 2 %; DTT 100 mM; bromophenol blue 0.1 %; Glycerol 10%) was resuspended, boiled for 5 min, centrifuged at 12 000 rpm for 1 min, and 20 μl of the supernatant was taken for SDS-PAGE detection. Stain with Coomassie brilliant blue R-250 staining solution (0.1% Coomassie brilliant blue R-250, 40% m...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com