Cell protective agent containing metallothionein
A metallothionein and protective agent technology, applied in animal cells, extracellular fluid diseases, vertebrate cells, etc., can solve problems such as death, low cell survival rate, and decline
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0034] Rat bone marrow mesenchymal stem cells (BMSCs) were isolated and cultured by density gradient centrifugation, and their differentiation into neural stem cells (NSCs) was promoted with a special medium for neural stem cells, and three concentrations of metallothionein were added to the medium The obtained bone marrow-derived neural stem cells (BMSCs-d-NSCs) were cultured in a CO2 incubator at 37°C, and detected by Annexin V-EGFP / PI double-staining flow cytometer at 1, 2, 3, and 4 weeks respectively , using the same cultured cells without adding metallothionein at the same time as the control, comparing the apoptosis and necrosis of each group. The results showed that after the subculture of cells in each group, the metallothionein treatment group had more vigorous vigor, faster proliferation and less apoptosis and necrosis than the control group. The proportions of apoptotic cells and necrotic cells were significantly different among the groups after 2 weeks of culture; ...
Embodiment 2
[0036] Take the bone marrow mononuclear cells of Balb / c mice, and use the plasma clot method to divide the cells (2x10 5 / petri dish) was added to the culture solution containing 10% 2-mercaptoethanol, 10% calcium chloride, 10% bovine serum albumin, 5% porcine serum, and 10% bovine plasma, and three kinds of 0.5μM, 1μM, 5μM The concentration of metallothionein in the culture solution was cultured in a CO2 incubator at 37°C, and detected by Annexin V-EGFP / PI double-stained flow cytometry at 1, 2, 3, and 4 weeks respectively. The cells cultured with sulfur protein at the same time were used as the control, and the apoptosis and necrosis of the cells in each group were compared. The results showed that after the subculture of cells in each group, the metallothionein treatment group had more vigorous vigor, faster proliferation and less apoptosis and necrosis than the control group. Flow cytometry showed that the percentages of apoptotic cells and necrotic cells were significantl...
Embodiment 3
[0038] The stable human iPS cells passaged by type IV collagenase digestion method were used to detect and identify human iPS pluripotency genes OCT4 (upstream primer CGAAGAGAAAGCGAACCAGTATC, downstream primer AGAACCACACTCGGACCACATC), Sox2 (upstream primer CCCCCGGCGGCAAATGCA, downstream primer TCGGCGCCGGGGAGATACAT), Nanog( The upstream primer is GCAAAAAAGGAAGACAAGGTCC, the downstream primer is CCTTCTGCGTCACACCATTG), and its stem cell characteristics are tested. Cultured in a CO2 incubator at 37°C with iPS stem cell medium supplemented with 0.5 μM, 1 μM, and 5 μM metallothionein cytoprotectant. The apoptosis and necrosis of each group were detected by flow cytometry as in the above examples. The proportions of apoptotic cells and necrotic cells were significantly different among the groups after 2 weeks of culture; the proportions of apoptotic and necrotic cells in the 1 μM and 5 μM metallothionein treatment groups were significantly less than those in the control group. The d...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com