Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene silencing technique based Laodelphax striatellus lethal gene fragment Alpha1-tubulin and dsRNA thereof

A technology of gene fragments and striatellus, applied in the field of agricultural biology, can solve the problems of poor chemical control effect and environmental pollution, and achieve the effects of reducing mechanical damage, convenient experimental operation, and low synthesis cost

Inactive Publication Date: 2013-07-17
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle
In addition, rice stripe leaf blight caused by stripe virus transmitted by SBPH is poorly controlled by pesticides after the onset, and can only be controlled by pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene silencing technique based Laodelphax striatellus lethal gene fragment Alpha1-tubulin and dsRNA thereof
  • Gene silencing technique based Laodelphax striatellus lethal gene fragment Alpha1-tubulin and dsRNA thereof
  • Gene silencing technique based Laodelphax striatellus lethal gene fragment Alpha1-tubulin and dsRNA thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Cloning method of Alpha1-tubulin gene fragment:

[0039] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0040] (2) Synthesizing the first strand of cDNA;

[0041] (3) Obtain the gene fragment sequence from the SBPH transcriptome. After homology comparison at http: / / www.ncbi.nlm.nih.gov / , it is predicted to be the SBPH Alpha1-tubulin gene, using Primer Premier 5.0 software designed P1 and P2, amplified by RT-PCR method;

[0042] Upstream primer (P1): 5'ACACCATCGGAAAGG 3'(SEQ ID NO.2),

[0043] Downstream primer (P2): 5'CACCGTCGAATCTCAATGA 3' (SEQ ID NO.3);

[0044] The PCR reaction program was: denaturation at 94°C for 2 min, 30 sec at 94°C, 30 sec at 55°C, 30 sec at 72°C, 35 cycles, and extension at 72°C.

[0045] PCR reaction system (50μL):

[0046]

[0047]

[0048] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0049] (5) Insert the recovered target fragment i...

Embodiment 2

[0053] Embodiment 2.dsRNA synthesis and recovery

[0054] (1) According to the verified Alpha1-tubulin gene fragment sequence, use Primer Premier 5.0 software to design P3 and P4, and add the T7 promoter sequence TAATACGACTCACTATAGGG to the 5' end of the upstream and downstream primers;

[0055] Upstream primer (P4): 5' TAATACGACTCACTATAGGG ACACCATCGGAAAGG 3' (SEQ ID NO.5)

[0056] Upstream primer (P5): 5'TAATACGACTCACTATAGGG CACCGTCGAATCTCAATGA 3'(SEQ ID NO.6)

[0057]

[0058] PCR reaction program: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0059] (2) The PCR product was separated by electrophoresis on a low-melting point agarose gel with a concentration of 1% and observed under ultraviolet light. The results are shown in figure 1 , whose sequence is shown in SEQ ID NO.4.

[0060] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0061] ① Cut the gel of the separated target fragmen...

Embodiment 3

[0071] Embodiment 3.dsRNA feeding experiment

[0072] (1) Seal one end of the glass tube with a parafilm, suck the second-instar SBPH into the glass tube with a sucker, and seal the other end with gauze;

[0073] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, put the prepared parafilm sticker up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0074] (3) Draw 100 μl of feed with a pipette gun and drop it in the center of the parafilm, the control only adds feed (see Table 2 for formula), and the treatment group adds dsRNA of Alpha1-tubulin gene (see Table 1 for concentration) in the feed, and use a new The parafilm, with the side of the sticker facing down, is pasted on the opening of the glass tube, and the feed and dsRNA are sealed between the two layers of parafilm;

[0075] (4) Put the glass tube with feed and dsRNA b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of agricultural and biological technology and relates to a gene silencing technique based Laodelphax striatellus lethal gene fragment Alpha1-tubulin and a dsRNA thereof. The invention is to screen the Laodelphax striatellus lethal gene fragment Alpha1-tubulin, which can lead to the death of Laodelphax striatellus after interference and has a sequence representedby SEQ ID No.1, from Laodelphax striatellus by using a laboratory improved dsRNA feeding method. When the dsRNA of the gene fragment is used for feeding Laodelphax striatellus, the adjusted mortalityof the Laodelphax striatellus may reach 70 percent, and a sequence basis and a data basis are provided for the construction of a new policy of controlling pests by using RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to Alpha1-tubulin, a lethal gene fragment of the small planthopper based on gene silencing technology, and dsRNA thereof. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interferen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12
Inventor 李飞李国清董双林韩召军姜卫华
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products