Laodelphax striatellus lethal gene fragment Ribosomal protein L9-B based on gene-silencing technology and dsRNA thereof

A technology of gene fragments and striatellus, applied in the field of agricultural biology, can solve the problems of poor chemical control effect and environmental pollution, and achieve the effect of being convenient for a large number of experiments, convenient for experimental operations, and reducing mechanical damage

Inactive Publication Date: 2011-10-19
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle
In addition, rice stripe leaf blight caused by stripe virus transmitted by SBPH is poorly controlled by pesticides after the onset, and can only be controlled by pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Laodelphax striatellus lethal gene fragment Ribosomal protein L9-B based on gene-silencing technology and dsRNA thereof
  • Laodelphax striatellus lethal gene fragment Ribosomal protein L9-B based on gene-silencing technology and dsRNA thereof
  • Laodelphax striatellus lethal gene fragment Ribosomal protein L9-B based on gene-silencing technology and dsRNA thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Cloning method of Ribosomal protein L9-B gene fragment:

[0039] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0040] (2) Synthesizing the first strand of cDNA;

[0041] (3) Obtain the gene fragment sequence from the SBPH transcriptome, and after homology comparison at http: / / www.ncbi.nlm.nih.gov / , it is predicted to be the SBPH Ribosomal protein L9-B gene, Use Primer premier 5.0 software to design P 1 and P 2, and use RT-PCR method to amplify;

[0042] Upstream primer (P1): 5'TTCTAGCGAGTTTCCG 3' (SEQ ID NO.2),

[0043] Downstream primer (P2): 5'GCGATGCCCAGTATGT 3' (SEQ ID NO.3);

[0044] The PCR reaction program was: denaturation at 94°C for 2 min, 30 sec at 94°C, 30 sec at 55°C, 30 sec at 72°C, 35 cycles, and extension at 72°C.

[0045] PCR reaction system (50μL):

[0046]

[0047]

[0048] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0049](5) Insert the re...

Embodiment 2

[0053] Embodiment 2.dsRNA synthesis and recovery

[0054] (1) According to the verified Ribosomal protein L9-B gene fragment sequence, Primer Premier 5.0 software was used to design P3 and P4, and the T7 promoter sequence TAATACGACTCACTATAGGG was added to the 5' end of the upstream and downstream primers;

[0055] Upstream primer (P 4): 5' TAATACGACTCACTATAGGG TTCTAGCGAGTTTCCG 3' (SEQ ID NO.5)

[0056] Upstream primer (P 5): 5' TAATACGACTCACTATAGGG GCGATGCCCAGTATGT 3' (SEQ ID NO. 6)

[0057]

[0058] PCR reaction program: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0059] (2) The PCR product was separated by electrophoresis on a low-melting point agarose gel with a concentration of 1% and observed under ultraviolet light. The results are shown in figure 1 , whose sequence is shown in SEQ ID NO.4.

[0060] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0061] ① Cut the gel of th...

Embodiment 3

[0071] Embodiment 3.dsRNA feeding experiment

[0072] (1) Seal one end of the glass tube with a parafilm, suck the second-instar SBPH into the glass tube with a sucker, and seal the other end with gauze;

[0073] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, put the prepared parafilm sticker up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0074] (3) Use a pipette gun to draw 100 μl of feed and drop it in the center of the parafilm. The control group only adds feed (see Table 1 for formula), and the treatment group adds dsRNA of Ribosomal protein L9-B gene in the feed, and the concentration of dsRNA is 3875ng / μl , with a new parafilm, with the sticker side facing down, stick it on the glass tube nozzle, and seal the feed and dsRNA between the two layers of parafilm;

[0075] (4) Put the glass tube with feed and dsRNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Belonging to the field of agricultural biotechnology, the invention relates to a laodelphax striatellus lethal gene fragment. By a laboratory improved dsRNA feeding method, the invention, from laodelphax striatellus, screens out the laodelphax striatellus lethal gene fragment Ribosomal protein L9-B which can lead to laodelphax striatellus death and has sequences as shown in SEQ ID No.1. Feeding laodelphax striatellus with the dsRNA of the gene fragment provided in the invention can have good lethal effect, thus providing sequence and data bases for establishing new strategies of pest control with RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to the lethal gene fragment Ribosomal protein L9-B and dsRNA thereof based on gene silencing technology. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is a ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N15/113C12N15/10A01K67/033
Inventor 李飞李国清董双林韩召军姜卫华
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap