Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof

A technology of molecular markers and bacterial strains, applied in biochemical equipment and methods, microbiological determination/testing, DNA preparation, etc. The development of the mushroom cultivation industry and other issues, to achieve the effect of short detection time, high accuracy, and speed up research and development

Inactive Publication Date: 2013-01-02
SHANGHAI ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Straw mushroom mycelia do not have lock-like associations, and most monokaryotic hyphae can complete the entire life cycle by self-mating. In classical genetic studies, straw mushrooms are the only basidiomycetes identified as belonging to the primary homophyletic reproduction mode among edible fungi. However, there are still many controversies on the genetics of straw mushrooms, especially the research on the reproductive model. The lack of these basic theoretical studies has restricted the development of cross-breeding of straw mushrooms, which has brought new challenges to the breeding of new varieties of straw mushrooms. Many difficulties have greatly limited the development of straw mushroom cultivation industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof
  • Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof
  • Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A method for obtaining specific molecular markers of Volvariella volvacea V23 strain includes:

[0029] (1) Extraction of genomic DNA

[0030] Straw mushroom V23 strain (purchased by the Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences) inoculate PDA plate medium, culture at 32°C for 5 days, scrape the surface hyphae into a sterile centrifuge tube, store at -70°C in the refrigerator for later use; use improved CTAB Method to extract genomic DNA, and store DNA in a refrigerator at -20°C for later use; the improved CTAB method specifically includes: grinding freeze-dried straw mushroom hyphae into powder and adding 2×CTAB extract (2% CTAB; preheated at 65°C; 1.4M NaCl; 100mM Tris.Cl, pH8.0; 20mM EDTA, pH8.0), incubate at 65°C for at least 45min, then 12000rpm, centrifuge at room temperature for 20min, take the supernatant and add an equal volume of chloroform: isoamyl alcohol (24: 1) Mix the mixture gently. After 15 minutes, centrifuge at room temperature ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a specific molecular marker of a volvariella volvacea V23 strain as well as an obtaining method and application thereof. The sequences of a PCR (polymerase chain reaction) amplification primer pair are GTGACTGCTATGGAACACATTGGAC and TCGGAGGAAGCGGGTCCACTACA; and the obtaining method comprises the following steps: (1) extraction of genome DNA (deoxyribonucleic acid); (2) PCRamplification reaction; and (3) agarose gel electrophoresis detection. The specific molecular marker is used for identifying the volvariella volvacea V23 strain and distinguishing single spore isolation strains. The method provided by the invention has the advantages of short detection time and high accuracy.

Description

Technical field [0001] The invention belongs to the technical field of identification of the genus Volvariella, and particularly relates to a specific molecular marker of a Volvariella V23 strain and its obtaining method and application. Background technique [0002] The cultivation of Volvariella volvacea originated in China. It has been cultivated for more than 300 years and is widely cultivated in southern my country. Straw mushroom is delicious, not only has rich nutritional value, but also has important medical and health care functions, and is deeply loved by consumers. As a kind of high-temperature cultivated edible fungus, compared with other edible fungi, its remarkable characteristic is that it grows very fast. It usually only takes 2 weeks from sowing to harvest. Its annual output has always been in the edible fungi industry in my country. Ranked in the top ten. [0003] Straw mushroom hyphae do not have a lock-like association, and most monocytic hyphae can mate by the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68C12Q1/04
Inventor 汪虹陈明杰鲍大鹏冯爱萍薛承琴
Owner SHANGHAI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap