Multi-copy integrated expression vector and preparation method and application thereof in expression of bovine lactoferrin
A technology of bovine lactoferrin and expression vectors, applied in the direction of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve problems such as cost reduction and disadvantages, and achieve the effects of reducing production costs and simplifying production processes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Acquisition of the lactoferrin gene:
[0065] In the process of translation from nucleic acid to protein, different species have different codon preferences. However, the codon preference of Saccharomyces cerevisiae and mammals is quite different. In order to enable the lactoferrin gene to be expressed more efficiently in Saccharomyces cerevisiae, the codon preference of S. The amino acid sequence of bovine lactoferrin is converted into a nucleic acid sequence suitable for expression in Saccharomyces cerevisiae. At the same time, issues such as the GC content of the entire nucleic acid sequence must be considered to avoid premature termination of the translation process. The designed nucleic acid sequence is compared with the bovine lactoferrin mRNA, and the comparison results show that the two nucleic acid sequences have only 78.9% similarity ( figure 1 ), indicating that there is a large difference in codon bias between yeast and mammalian cattle.
[0066] After int...
Embodiment 2
[0068] Construction of multi-copy integrated expression vector ( figure 2 )
[0069] (1) Construction of carrier backbone pYB-1:
[0070] (i) Amplification of the Bgl fragment: Using YIPlac204 as a template and primers b1 and b2 as primers, the Bgl fragment was amplified by PCR technology and Aat II, EcoR I and Bgl II restriction sites were introduced at both ends of it. The primer sequences are as follows: the underlined part is the recognition site of Bgl II, the shaded part is the recognition site of Aat II, and the sequence in the frame is the recognition site of EcoR I.
[0071] Primer b1: 5'GACGTC AGATCTA TTCTTGCCACGACTCATCTCC 3': (SEQ ID N0.2)
[0072] Primer b2: 5' AGATCT GATTCCGATGCTGACTTGCTG 3': (SEQ ID N0.3)
[0073] The PCR reaction conditions were 94°C for 2 min, 94°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec, the cycle was repeated 34 times, and 72°C for 10 min. A DNA fragment of 280 bp was obtained by PCR. After the fragment was purified and re...
Embodiment 3
[0103] The application of multi-copy integrated expression vector in expressing bovine lactoferrin, the steps are as follows:
[0104] (1) Digest bLF and vector pYIP-6 with Not I, and ligate the fragments recovered by gel cutting, transform the E. coli TOP10 strain with the ligation solution, and coat LB (100 μg / mL ampicillin) plates. After picking a number of transformants for a small amount of plasmid preparation, Not I was used for enzyme digestion verification ( image 3 ). After digestion, a vector fragment with a size of about 7940bp and a released bLF fragment with a size of about 2142bp were obtained. Several transformants with bLF inserted were sent for sequencing, and the sequence results were analyzed, and the transformant with reversely inserted bLF was named pYIPLF.
[0105] (II) Screening of transforming Saccharomyces cerevisiae ABXL-1D with pYIPLF and transformants containing high-copy bLF: extracting pYIPLF plasmid, digesting with Hpa I, cutting gel to recove...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com