Method for preparing recombinant duck alpha-interferon
A crude technology of interferon, applied in the field of preparation of recombinant duck α-interferon, can solve the problems of hyperimmune serum carrying and spreading other diseases, decreased protection rate, no protective effect, etc. Reduce production costs, no toxic side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: (the synthesis of duck α-interferon gene and the construction of expression vector)
[0035] (1) Duck α-interferon gene synthesis: The duck α-interferon gene sequence published by Genebank (No. X84764) was sent to Shanghai Boya Biotechnology Co., Ltd. for synthesis. The synthetic duck α-interferon gene has removed the signal peptide gene and is a mature duck α-interferon protein gene, and its sequence is as follows:
[0036] tgcagccccctgcgcctccacgacagcgccttcgcctgggacagcctccagctcctccgcaacatggc
[0037] tcccagccccacacagccctgcccgcagcaacacgcgccttgctccttcccggacaccctcctggaca
[0038] ccaacgacacgcagcaagccgcacacaccgccctccacctcctccaacacctcttcgacaccctcagc
[0039]agccccagcacccccgcgcactggctccacaccgcacgccacgacctcctcaaccagcttcagcacca
[0040] catccaccaccttgagcgctgcttcccagccgacgccgcgcgcctccacaggcgagggccccgcaacc
[0041] ttcacctcagcatcaacaagtacttcggctgcatccaacacttcctccagaaccacacctacagcccc
[0042] tgcgcatgggaccacgtccgcctcgaggctcacgcctgcttccagcgcatccaccgcctcacccgcac ...
Embodiment 2
[0049] Example 2: (engineering bacteria induced expression, inclusion body extraction, protein purification and renaturation)
[0050] (1) Induced expression of engineering bacteria: inoculate the LB culture fluid containing 50ug / ml kana with the engineering bacteria of embodiment 1 and cultivate overnight at 37°C, and in the next day, the bacterial fluid is inoculated with the above-mentioned same LB medium by the inoculum of 2%. , cultured at 37°C to OD 600 If the value is 0.6-0.7, add an IPTG inducer with a final concentration of 1 mmol to induce culture for 4 hours; take the bacterial solution and centrifuge at 4000 rpm for 10 minutes to collect the bacterial cells, and store them in a -70°C refrigerator for later use;
[0051] (2) Inclusion body extraction: resuspend the collected bacteria with the lysis buffer prepared by 50mM phosphate buffer, 300mM NaCl, 10mM β-mercaptoethanol, pH 7.8 at a ratio of 1:4 by weight; use a high-pressure homogenizer at 650 Under Pa pressur...
Embodiment 3
[0054] Embodiment 3: (determination of crude duck α-interferon biological activity)
[0055] Using the micro-cytopathic inhibition method, detect the activity of the expression product on the duck embryo fibroblast cell line with vesicular stomatitis virus VSV: first, the expression product of Example 2 is diluted 10 times to 1000 times with MEM cell culture medium and then diluted To 64,000 times, add to duck embryonic fibroblasts (DEFs) in a monolayer on a 96-well cell culture plate, 20ul per well, 5 wells for each dilution, add 160ul of MEM maintenance solution, and culture at 37°C for 24 hours Pour off the culture medium and inoculate 100 TCID 50 VSV (20ul per well), after adding 160ul of MEM maintenance solution, continued to culture for 96h; it was found that 100 TCIDs were inoculated 50 After VSV, the control group 1 treated with refolding solution (50mM acetic acid buffer, 50mM NaCl, pH 7.0) and the control group 2 without any treatment just appeared the lesions such ...
PUM
Property | Measurement | Unit |
---|---|---|
purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com