Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Preparation method of acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and fluorine resistance capacities as well as application thereof

A technology of Thiobacillus ferrooxidans and genetically engineered strains, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of activity decline, death, slow growth rate, etc.

Inactive Publication Date: 2010-03-03
NANHUA UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although Thiobacillus ferrooxidans has appealing advantages, its disadvantages are also obvious, mainly reflected in the slow growth rate, reduced oxidation ability or even death under high fluoride ion concentration, the optimum growth temperature is 30°C, and the activity decreases rapidly at high temperature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and fluorine resistance capacities as well as application thereof
  • Preparation method of acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and fluorine resistance capacities as well as application thereof
  • Preparation method of acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and fluorine resistance capacities as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0210] Example 1. Construction of the shuttle plasmid pJRD215-PT with expression ability

[0211] (1) Synthesis of amplification primers: PCR oligonucleotide amplification primers were designed according to the pQE30 plasmid sequence provided by Qiagen. T5 promoter upstream primer: GGC GTC GAC CTCGAGAAATCATAAAAAAT (underlined endonuclease SalI site), downstream primer: TA TCTAGA ACCCGGGGTACCGAGCTC (underlined endonuclease XbaI site). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by ULTRAPAGE.

[0212] (2) Extraction of pJRD215 and pQE30 plasmids: Streak culture on the plate overnight, pick a single clone and inoculate it in a liquid medium for culture, collect 6 mL of bacteria and extract the plasmids according to the instructions of EasyPure Plasmid MiniPrep Kit of Quanshijin Company. The mentioned plasmid solutions were stored at -20°C until use.

[0213] (3) Amplification of T5 promoter and T0 terminator: the reaction system is H 2 ...

Embodiment 2

[0218] Embodiment 2. PCR amplification of Micrococcus luteus rpf gene

[0219] (1) Synthesis of amplification primers: PCR oligonucleotide amplification primers were designed according to the rpf gene sequence of Micrococcus luteus published in GenBank. Upstream primer (B-F): ATC GGTACC ATGGACACCATGACTCTC (underlined endonuclease KpnI site), downstream primer (B-R): tgaaccacctgaaccacctgaaccacctgaaccacc GGCCTGCGGCAGGACGAG (GGS chain underlined). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by ULTRAPAGE.

[0220] (2) Extraction of Micrococcus luteus genomic DNA: Micrococcus luteus was streaked on a brain-heart solid plate and cultured in 2ml of liquid medium. Genomic DNA was extracted according to the kit instructions. First, add 200 μl buffer GA to the cell pellet, shake until the cells are completely suspended, add 20 μl proteinase K solution to the tube, mix well, add 20 μl proteinase K solution to the tube, mix well, briefly centrif...

Embodiment 3

[0225] Example 3. PCR amplification of the C. crescentus cc3302 gene

[0226] (1) Synthesis of amplification primers: PCR oligonucleotide amplification primers were designed according to the cc3302 gene sequence of Caulobacter crescentus published in GenBank. Upstream primers (C-F): ggtggttcaggtggttcaggtggttcaggtggttca ATGTGGCGGTCGCCTGTG (GGS chain is underlined), downstream primer (C-R): agatcctccagatcctccagatcctccagatcctcc ATTACGCGTCATGACTGAG (GGS chain is underlined). Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by ULTRAPAGE.

[0227] (2) Extraction of Genomic DNA of Caulobacter crescentus: Streak culture of Caulobacter crescentus on a solid plate, pick a single clone to culture in 2ml liquid medium, and use Tiangen Company bacterial genomic DNA extraction reagent after centrifugation to collect the bacteria Box instructions for extraction of genomic DNA. First, add 200 μl buffer GA to the cell pellet, shake until the cells are com...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of an acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and fluorine resistance capacities as well as the application thereof, wherein the strain is Acidithiobacillus ferrooxidans QEY-6(pJRD215-PT-rcf), CCTCCM 209156; and the preparation method comprises the following steps: firstly, augmenting a T5 promoter and a T0 terminator of pQE30, and establishing a shuttle expression vector pJRD215-PT together with pJRD215; secondly, augmenting and cloning a micrococcus luteus rpf gene, a caulobacter crescentus cc3302 gene and a caenorhabditis elegans flr-4 gene to a T vector; thirdly, establishing a recombined shuttle expression vector pJRD215-PT-rcs; and fourthly, establishing the acidithiobacillus ferrooxidian genetic engineering strain which fusedly expresses rpf, cc3302 and flr-4 genes. The invention has simple operation and good repeatability, and can improve the tolerance of ores containing uranium and fluorine, shorten the uranium leaching period, improve the leaching rate and reduce the acid-consuming rate.

Description

technical field [0001] The invention relates to a method for preparing a Thiobacillus ferrooxidans genetically engineered strain that expresses Micrococcus luteus reactivation-promoting factor (resuscitation-promoting factor, rpf), Caulobacter crescentus cc3302 gene and Caenorhabditis elegans flr-4 gene And its application in uranium ore leaching. Background technique [0002] Acidithiobacillus ferrooxidans (T.f) is one of the important ore leaching microorganisms. It obtains energy by oxidizing ferrous iron, elemental sulfur and reduced sulfur compounds, and produces ferric iron, sulfuric acid, etc. during the growth process. The leaching agent can reduce the production cost. At the same time, the Thiobacillus ferrooxidans can self-reproduce and amplify, and can be recycled, thus further reducing consumption. Therefore, more and more attention has been paid to the research on leaching gold, silver, copper, uranium, etc. by using Thiobacillus ferrooxidans. [0003] Althoug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C22B3/18C22B60/02C12R1/01
Inventor 丁德馨李广悦王永东刘劼胡南刘玉龙王有团
Owner NANHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com