CpG methylated oligodeoxynucleotide for inhibiting replication of hepatitis b virus (HBV)
A hepatitis B virus and deoxynucleotide technology, applied in the field of oligodeoxynucleotides, can solve the problem of no HBVcccDNA CpG island methylation, etc., and achieve the effects of easy production and storage, inhibition of replication, and high stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] The following experiment shows that the selected CpG methylated oligonucleotide can specifically induce the CpG methylation of the complementary sequence of HBV cccDNA and can inhibit HBV DNA replication.
[0051] (1) According to HBV GenBank: CpG island 2 positive strand sequence of U95551.1 strain, select two positive strand sequences containing CpG, artificially synthesize CpG methylated oligodeoxynucleotides MX1, MX2, and respectively with The sequences of unmethylated oligodeoxynucleotides X1 and X2 with the same sequence as MX1 and MX2 are:
[0052] MX1 (methylated): 5'catcagm5cgm5cgtgm5cgtggaa 3' (1227-1245nt)
[0053] X1 (unmethylated): 5'catcagcgcgtgcgtggaa 3' (1227-1245nt)
[0054] MX2 (methylation): 5'gtcctctccm5cgcaaatatacatm5cgt 3' (1347-1371nt)
[0055] X2 (unmethylated): 5'gtcctctcccgcaaatatacatcgt 3' (1347-1371nt)
[0056] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0057] MX1 and X1 are methylated and unmethylated ol...
Embodiment 2
[0066] According to the positive strand sequence of CpG island 2 of the HBV A genotype strain, two positive strand sequences containing CpG were selected, and the corresponding CpG methylated oligodeoxynucleotides MX1 and MX2 were artificially synthesized, and respectively combined with MX1 and MX2 The sequences of unmethylated oligodeoxynucleotides X1 and X2 with the same sequence are:
[0067] MX1: 5'catcagm5cgcatgm5cgtggaa3' (1225-1243nt)
[0068] X1: 5'catcagcgcatgcgtggaa3' (1225-1243nt)
[0069]MX2: 5'gtcctctm5cgm5cggaaatatacatm5cgt3' (1345-1369nt)
[0070] X2: 5'gtcctctcgcggaaatatacatcgt3' (1345-1369nt)
[0071] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0072] The implementation is similar to Example 1.
Embodiment 3
[0074] According to the positive strand sequence of CpG island 2 of the HBV genotype strain, two positive strand sequences containing CpG were selected, and the corresponding CpG methylated oligodeoxynucleotides MX1 and MX2 were artificially synthesized, and respectively combined with MX1 and MX2 The sequences of unmethylated oligodeoxynucleotides X1 and X2 with the same sequence are:
[0075] MX1: 5'catcagm5cgcatgm5cgtggaa 3' (1225-1243nt)
[0076] X1: 5'catcagcgcatgcgtggaa 3' (1225-1243nt)
[0077] MX2: 5'gtgctctccm5cgcaagtatacatcat 3' (1345-1369nt)
[0078] X2: 5'gtgctctcccgcaagtatacatcat 3' (1345-1369nt)
[0079] Synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0080] The implementation is similar to Example 1.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com