Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof

A technology of Enterobacter sakazakii and antibodies, which is applied in the field of enzyme-linked immunosorbent assay for the detection of bacteria, and can solve the problem of no prompting antibodies

Inactive Publication Date: 2007-12-05
SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
View PDF5 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this gene is similar to the sequence published by A. Lehner et al. (See: Systematic and Applied Microbiology, 29:609-625 and AMO75208 in the EMBL nucleic acid database), the work of A. Lehner et al. was to study the metabolic pathway of Enterobacter sakazakii Yes, there is no suggestion to use it to prepare antibodies for ELISA detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Cloning of Enterobacter sakazakii alpha-glucosidase gene

[0027] Take Enterobacter sakazakii ATCC29544 strain (purchasable from American Type Culture Collection (ATCC)) and inoculate it in LB broth, culture overnight at 37°C with shaking at 200rpm, collect the genomic DNA extracted from the bacteria as a PCR template, and clone as follows: Primer pairs for PCR amplification:

[0028] 5'AGGAGGGGTAATGAGTGAAG3', 5'TTGATACCTCACGACGTCAG3'. PCR conditions: 94°C for 5 minutes, 30 cycles (94°C for 30 seconds, 56°C for 90 seconds, 72°C for 60 seconds), 72°C for 5 minutes.

[0029] Agarose electrophoresis recovered a PCR product with a size of about 1677bp, and then used the PCR product as a template to perform PCR amplification with the following expression primer pair, respectively introducing BamHI and XhoI restriction sites: 5'ACTGC ggatccg ATGAGTGAAGCACCGACGCAG3', 5'TCAGTGC ctcgag CGACGTCAGTTTATAAACC3'. The pET22b(+) plasmid (available from Invitrogen) and th...

Embodiment 2

[0030] Example 2 Expression and purification of Enterobacter sakazakii alpha-glucosidase

[0031] Pick the transformant clone verified by Example 1, activate overnight, inoculate in LB broth with 1%, add IPTG at a ratio of 0.5mM / L, induce for 3 hours at 37°C, centrifuge (8000rpm, 5 minutes), discard The cells were collected and frozen at -20°C. The cells were resuspended with 40ml binding buffer (containing 20mM Tris-HCl, 200mM NaCl, pH 8.0), and the cells were disrupted by ultrasonication. Then, it was centrifuged at 13000 rpm for 30 minutes at 4° C., and the supernatant was collected and loaded on SDS-PAGE to observe the induced expression. As a result, as shown in Fig. 1, it was apparent that a protein of about 65 kD (ie, the size of Enterobacter sakazakii α-glucosidase) was expressed.

[0032]Take a Ni-NTA column (available from US PE Company), and equilibrate it with more than 10 column volumes of binding buffer (containing 20 mM Tris-HCl, 200 mM NaCl, pH 8.0). The sup...

Embodiment 3

[0033] Example 3 Preparation of Enterobacter sakazakii alpha-glucosidase antibody

[0034] Using the hybridoma technology described in G.Kohler and C.Milstein (Nature, 256:495-497 (1975)), the difference is that the antigen of the present invention (i.e., expressed and purified Enterobacter sakazakii α- Glucosidase) was used to prepare hybridoma cells through Kunming mice, and 24 hybridoma cell lines were selected.

[0035] Liquid paraffin (0.5ml per mouse) was injected intraperitoneally into the mice first. Seven days later, the hybridoma cell lines were respectively inoculated into the intraperitoneal cavity of mice injected with liquid paraffin, and each mouse was intraperitoneally injected with 1-5×10 6 a hybridoma cell. After 10 to 14 days, ascitic fluid was collected, centrifuged at 10,000 g for 5 minutes, and the supernatant was taken and diluted with an equal volume of pH 7.0 phosphate buffer. After dilution, slowly add saturated ammonium sulfate solution equal to t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detecting method (ELISA) of enzyme link immune suction of banqi-enterobacteria and antibody and alpha-glucosidase and coded nucleic acid and carrier of the antibody, which is characterized by the following: using the amino acid sequence of alpha-glucosidase as Seq ID No:2; using ELISA of antibody to make agent box of the antibody; detecting the banqi-enterobacteria rapidly and effectively; providing high sensitivity, strong specificity and reliable result.

Description

technical field [0001] The invention relates to an enzyme-linked immunosorbent assay (ELISA) technique for detecting bacteria, in particular to an enzyme-linked immunosorbent assay method for detecting Enterobacter sakazakii. In addition, the present invention also relates to the antibody used in the ELISA method and the Enterobacter sakazakii α-glucosidase required for the preparation of the antibody, as well as its encoding nucleic acid, vector and the like. Background technique [0002] Enterobacter sakazakii (Enterobacter sakazakii) is a Gram-negative bacterium of the Enterobacter genus, which was called "Yellow Enterobacter cloacae" before 1980. As a source of pollution in milk and milk product processing and finished products, Enterobacter sakazakii can cause infantile and adult diseases including infantile meningitis, sepsis, sepsis and enterocolitis, etc., and may cause neurological disorders, resulting in severe sequelae and death. For example, 19 of the 76 cases ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/53C12Q1/10G01N33/577C12Q1/68C12N5/12
CPCY02A50/30
Inventor 杨捷琳顾鸣黄应峰
Owner SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com