Supercharge Your Innovation With Domain-Expert AI Agents!

Antigen and ligand PCR pipe detecting reagent case, its manufacturing method and application

A technology for detection kits and detection reagents, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of inability to quantify, primers that cannot solve the problem of impurity, primer dimer amplification, etc., and achieve high sensitivity and mechanized synthesis The effect of high precision and large amount of stored information

Inactive Publication Date: 2006-01-18
甘肃省医学科学研究院
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Impurity and primer-dimer amplification cannot be resolved with labeled primers and, therefore, cannot be quantified
[0020] Despite these remarkable advances, diagnostic methods still need improved sensitivity, reduced manual manipulation, and improved dynamic monitoring to quickly analyze the presence and quantification of targets in samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen and ligand PCR pipe detecting reagent case, its manufacturing method and application
  • Antigen and ligand PCR pipe detecting reagent case, its manufacturing method and application
  • Antigen and ligand PCR pipe detecting reagent case, its manufacturing method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0106] Example 1: Novel Immuno-PCR Detection

[0107] refer to figure 2 , is a new PCR detection process. After the PCR tube is treated, it is coated with an antibody, and incubated with the test sample to form an antibody-antigen complex; after washing, add a ligand-labeled detection antibody, and after incubation, wash Remove unbound detection antibodies, PCR amplification for ligand modification sequences, analysis and processing of amplified products. The specific steps are as follows:

[0108] 1. Preparation of detection PCR tube: Treat the PCR tube with 3.5% glutaraldehyde at 37° C. for 2 hours, wash it three times with three-distilled water, and coat the monoclonal antibody (or capture ligand, see Example for coating method) to capture hepatitis B core antigen Two, 1), block with 5% skimmed milk powder (or bovine serum albumin, etc.), 50 ul of 1.0 mol pH9.6 sodium bicarbonate buffer, and dry for use.

[0109] 2, the preparation of detection antibody reagent: will de...

Embodiment 2

[0118] See for reference image 3 , Ligand detection; After the PCR tube is treated, the ligand that is coated with the recognition ligand is incubated with the detection sample to form a ligand-ligand complex; after cleaning, the recognition and detection ligand labeled with the modified sequence is added After co-incubating with different ligands, the unbound detection ligands are washed away, and the PCR amplification of the ligand modification sequence, the analysis and processing of the amplified products. The specific steps are as follows:

[0119] 1. Preparation of PCR tubes: Treat PCR tubes with 3.5% glutaraldehyde at 37° C. for 2 hours, wash three times with three-distilled water, and coat streptavidin; use 5% skimmed milk powder (or bovine serum albumin and poly( dI.dC), etc.), PH9.6 sodium bicarbonate buffer was treated at 37 ° C for 2 hours to block, and 1ml 1.0mol pH9.6 sodium bicarbonate buffer was rinsed three times for three minutes each time; the captured mou...

Embodiment 3

[0129] refer to Figure 5 , real-time quantitative-PCR simultaneously detects four ligands

[0130] 1. Preparation of detection PCR tube: Treat the PCR tube with 3.5% glutaraldehyde at 37°C for 3 hours, wash it three times with steamed water, and coat it with streptavidin; use 5% skimmed milk powder (or bovine serum albumin and poly (dI.dC) etc.), PH9.6 sodium bicarbonate buffer was treated at 37°C for 2 hours to block, rinsed three times with 1ml1.0mol pH9.6 sodium bicarbonate buffer for three minutes each time; the four captured The ligand of the ligand, concentration: 25pmol, namely:

[0131] 1) peptide from HIV-1 Rev,

[0132] Biotin-5'-

[0133] GCUUGGUACCGAGCUCGGAUCCACGUAGUAACGGGCCGCCAGU

[0134] GUGCUGGAAUUCGGGUCGUUCUUG-3;

[0135] 2) NS3 protease protein,

[0136] Biotin-5'-

[0137] GGGAACUCGAUGAAGCGAAUUCUGUGUAUCCUGUACGCAAG

[0138] UACUAGCCAUACAGGCCUAUCUAUCGGAUCCACG-3';

[0139] 3) TAR RNA element of HIV-1,

[0140] Biotin-5'-

[0141] CCCGAGCCAGCAUAGCUACG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antigen used PCR pipe as adhering materials, dentate measuring device and the corresponding agent box. The method uses PCR pipe (polystyrene and so on), which has been operated by glutaral and so on (double function molecule) to adhere nucleotide dentate (or antigen, antibody and aglucon). It changes dentate signal into nucleotide aglucon signal by directly combining anomaly oligonucleotide aglucon (or anomaly oligonucleotide aglucon with signal molecule) with dentate, and then detests dentate by PCR (or rolling ring copy) amplifying and measuring.

Description

technical field [0001] The present invention relates to a PCR tube-type detection kit for antigen and ligand and its preparation method and application, in particular to a kit assembled by PCR tube that can directly detect antigen and ligand and its preparation and application . Background technique [0002] Early protein detection is based on the low dissociation constant and certain specificity of the antibody and the specific protein to be tested. The antibody capture method is a simple and convenient screening method. In the antibody capture method, the antigen is coated on a solid support, and then the antibody is used to bind the antigen, the plate is washed to remove the unbound antibody, and finally the bound antibody is detected by a labeled molecule that specifically recognizes the bound antibody. Many antibody capture methods use Indirect method to detect antibodies. For example, the detection antibody is a mouse antibody and the detection molecule may be a dete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/547G01N33/532G01N33/533G01N33/535G01N33/534
Inventor 廖世奇
Owner 甘肃省医学科学研究院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More