Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nuclear factor-K B P65 subunit antagonistic peptide and its use

A nuclear factor and antagonistic peptide technology, applied in the field of medicine, can solve difficult-to-reach problems

Inactive Publication Date: 2005-10-19
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is difficult to achieve this goal by interfering with the upstream pathway of NF-κB activation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nuclear factor-K B P65 subunit antagonistic peptide and its use
  • Nuclear factor-K B P65 subunit antagonistic peptide and its use
  • Nuclear factor-K B P65 subunit antagonistic peptide and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] Example 1, GST fusion expression and purification of nuclear factor-κB p65 subunit antagonistic peptide

[0120] According to the gene sequences of PT1, PT2, PT3, and PT4 polypeptides, while keeping the polypeptide protein coding sequence unchanged, according to the codon preference of Escherichia coli, respectively design and synthesize complementary DNAs with BamHI in the upstream sequence and SalI cohesive ends in the downstream sequence Fragment, the DNA sequence is as follows:

[0121] PT1-FP: 5'-GATCGTTGTAATGATCGAAGTAGTTTTTCCTGTAG-3',

[0122] PT1-RP: 5'-TCGACTACAGGAAAACTACTTCGATCATTACAAC-3'

[0123] PT2-FP:

[0124] 5'-GATCCTGGCGATGGTTGAAGTAACTGTTGTTCTGTCTTGGGGTTTCACTTAG-3'

[0125] PT2-RP: 5'-

[0126] TCGACTAAGTGAAACCCCCAAGACAGAACAACAGTTACTTCAACCATCGCCAG-3’

[0127] PT3-FP:

[0128] 5′-GATCCCGGCGATGGTTGAAGTAACTGTTGTTCTGTCTTGGGGTTTCACTTAG-3′

[0129] PT3-RP:

[0130] 5′-TCGACTAAGTGAAACCCCAAGACAGAACAACAGTTACTTCAACCATCGCCGG-3′

[0131] PT4-FP:

[0132]...

Embodiment 2

[0137] Example 2, Biosensor (Biosensor) detects the combination of GST fusion peptide and nuclear factor-κB p65 subunit

[0138] Put the carboxymethyl dextran biosensor chip into the microfluidic chuck of the Iasys Plus system, rinse with 60 μl PBS / T (pH 7.4PBS, 0.05% Tween 20) for 3 times, equilibrate for 10min, and collect after the baseline leveled off Baseline data for 5 minutes; mix EDC and NHS at a ratio of 1:1, take 40 μl of the mixed solution to wash the sample pool twice, then add 40 μl of the mixed solution to the sample pool, and keep it for 7 minutes to activate the surface of the sensor sheet; use 50 μl of PBS / T Rinse the sample pool 3 times to collect the baseline value for 1 min; wash the sample pool with 40 μl of 10 mM pH5.5 acetate buffer solution for 3 times, then add 40 μl of acetate buffer solution, and collect the baseline value for 1 min; then add 40 μl of acetate buffer solution to the sample pool The total amount of dilution is about 0.5 μg of p65 sta...

Embodiment 3

[0141] Example 3, ELISA method to detect the specific binding of GST fusion peptide and nuclear factor-κB p65 subunit

[0142] Wash the coated wells of the ELISA plate with deionized water several times, invert the plate, and tap the plate on a clean filter paper to remove the remaining water; dilute the p65 protein with PBS buffer at a concentration of 10 μg / ml; add 100 μl of the diluted p65 protein Put it into the coated wells of 96-well ELISA plate, incubate at room temperature for 3-4 hours or overnight at 4°C, pay attention to the evaporation of water; wash the wells with 300 μl PBS three times to remove unbound p65 protein; prepare 5% aqueous solution of skimmed milk powder , add 200μl per well, incubate at room temperature for 1h or incubate overnight at 4°C to seal the coated wells; use protein binding buffer (50mM Tris-HCl, pH7.2, 100mM NaCl, 10mM MgCl 2 , 10uM ZncL 2 , 1mM DTT, 0.1% (v / v) NP40) to wash the plate 5 times; add 0.5μmol / L GST fusion peptide (diluted i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to nuclear factor-kappa B p65 subunit antagonisbic peptide and its application, and is especially one group of nuclear factor-kappa B (NF-p65 kappa B) p65 subunit antagonisbic peptide for treating. More particularly, the present invention is one group of small molecular peptides capable of combining specifically with nuclear factor-kappa B p65 subunit. The present invention also relates to the preparation and application of these nuclear factor-kappa B p65 subunit antagonisbic peptides.

Description

technical field [0001] The present invention relates to the field of medicine, in particular to a group of nuclear factor-κB (NF-κB) p65 subunit antagonistic peptides for treatment, more specifically, to a group of peptides capable of specifically binding to nuclear factor-κB p65 subunit and inhibiting it. Active small molecule peptides. The present invention also relates to the preparation and application of these nuclear factor-κB p65 subunit antagonistic peptides. Background technique [0002] NF-κB is a transcription factor ubiquitously present in the cytoplasm of almost all cells. It is the convergence point of various signal transduction pathways and has the functions of regulating various immune responses, inflammatory responses, virus replication, cell apoptosis and proliferation and Function of growth and development-related gene expression. NF-κB is a dimeric protein composed of two Rel family proteins. According to the differences in structure, function and syn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/10A61P29/00A61P31/12A61P35/00A61P43/00C07K7/08
Inventor 徐祥梁华平王正国
Owner THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com