Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Dendritic cell tumor vaccine and its preparation and use

A technology of dendritic cells and cells, applied in the fields of biology and medicine, can solve the problems of unfavorable applications, limited clinical use, low transfection efficiency, etc.

Active Publication Date: 2005-04-20
上海海欣生物技术有限公司
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantages of using the fusion cells of tumor cells and DCs as tumor vaccines are: the preparation period is longer, the fusion rate is low, the in vitro operation is complicated, there are many uncertainties, and it is difficult to apply in large scale clinically.
However, the disadvantage of this method is that the specific antigens of most tumors have not yet been clarified, and the antigen mutations of tumors can resist the immune attack of a single antigen, which is not conducive to its application in other tumor treatments.
However, the disadvantages are: due to the need to use vectors to mediate gene transfection, the preparation process is more complicated, and because DC is a differentiated terminal cell, its transfection efficiency is low and alternative vectors are limited, which is not suitable for its large-scale use
However, the transfection efficiency is low (usually less than 50%) when DCs are sensitized with tumor RNA, thus limiting the clinical use of tumor RNA-sensitized DC vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dendritic cell tumor vaccine and its preparation and use
  • Dendritic cell tumor vaccine and its preparation and use
  • Dendritic cell tumor vaccine and its preparation and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Establishment and screening of tumor cell lines with high expression of HER2

[0098] The present invention uses the following primers

[0099] Upstream primer: 5'CGCTCGAGCACC ATG GAGCTGGCGGC 3' (SEQ ID NO: 1)

[0100] Downstream primer: 5'CGAAGCTTGAGCAGAGAGCCAGCCC 3' (SEQ ID NO: 2)

[0101] The human HER2 proto-oncogene extracellular region fragment was cloned from the human breast cancer cell line SK-BR-3 (available from the American Type Culture Collection, ATCC HTB-30) by standard RT-PC method, and the sequence was correct. Insert pCDNA3.1 (Invitrogen) to construct HER2 eukaryotic expression vector pCDNA3.1-HER2. Using conventional liposome transfection method, the expression vector pCDNA3.1-HER2 was introduced into human breast cancer cell line MCF-7 (available from American Type Culture Collection, ATCC HTB-22) and mouse colon cancer cells. Line CT26 (can be purchased from the American Type Culture Collection, ATCC CRL-26), was selected and cultivated by G418...

Embodiment 2

[0103] Preparation and purification of HER2 mRNA

[0104] (a) Preparation of HER2 mRNA:

[0105] For the tumor cell clones highly expressing HER2 obtained in Example 1 (ie breast cancer cell line MCF-7 or mouse colon cancer cell line CT26 highly expressing HER2), a large amount of amplification was performed, and then the cells were collected. Wash twice with PBS, discard the supernatant, and place in an ice bath. Add guanidine isothiocyanate denaturing solution (20ml / 1×10 8 Cells), mix quickly to lyse the cells quickly and thoroughly. Add 2ml of 2mol sodium acetate (PH 4.0), mix well and transfer to a 50ml centrifuge tube. Add 22ml of phenol: chloroform: isoamyl alcohol (25:24:1), mix vigorously by inverting, and place on ice for 10 min. Carefully pipette the upper aqueous phase containing RNA, transfer to a new 50ml centrifuge tube, add an equal volume of isoamyl alcohol, and precipitate at -20°C for 1 hour. Centrifuge at 4°C, 12000rpm×15min. Discard the supernatant, a...

Embodiment 3

[0109] HER2 mRNA sensitized dendritic cells

[0110] Collect the human or mouse cultured dendritic cells cultured to day 6, wash twice with serum-free RPMI 1640, and adjust the cell concentration to 1×10 with serum-free RPMI 1640 7 / ml. Take 0.4ml of cell suspension and add it into a 0.2-cm electric shock cup, add 30μg of HER2 mRNA at the same time, and mix well. After 10 minutes of ice-bath in the electric shock cup, wipe it dry, and put it into the electric shock chamber of the ECM 830 electroporator of BTX Company for electroporation. After electroporation, gently take out the electric shock cup, and ice bath for 10 minutes. Carefully remove the cell suspension and add fresh DC complete medium at 37 °C 5% CO 2 Continue to culture in the incubator for 20 hours, add TNF-α to stimulate for 24 hours to promote DC maturation, collect cells, and irradiate with 30 Gy radiation for later use. At the same time, dendritic cells were transfected with EGFP mRNA and detected by flow ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Said invention provides tumor antigen mRNA sensitized dendritic cell tumor vaccine, preparation and use thereof, and medicinal composition of dendritic cell. Said tumor vaccine is specific mRNA modified dendritic cell vaccine which can stimulate body to produce specific immune response aiming at HER2 positive tumor, so it can be used in preventing and curing HER2 positive tumor such as breast cancer etc. said invention has high transfection efficiency, wide anti tumor gammarayspectrum and strong specificity.

Description

technical field [0001] The present invention relates to the fields of biology and medicine, and more particularly relates to a tumor antigen mRNA (such as HER2 mRNA) sensitized dendritic cell tumor vaccine and its preparation method and application. Background technique [0002] HER2 is a common oncogene in human tumors, closely related to the occurrence and development of tumors, and is the second member of the epidermal growth factor receptor (EGFR) family. The epidermal growth factor receptor family, also known as HER or ErbB2 family, plays an important role in cell signal transduction and is an important regulator of cell growth, differentiation and survival. [0003] The human HER2 gene is located on the short arm of chromosome 17, and the expression product is a single-chain transmembrane glycoprotein with a molecular weight of 185KDa, namely p185. p185 contains 1255 amino acid residues, the intracellular segment has tyrosine kinase activity, and is a tyrosine kinase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/00A61K45/00A61P35/00C12N5/08C12N5/10
Inventor 王建莉王宝梅夏大静
Owner 上海海欣生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com